Sesleria argentea

(Savi) Savi · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Sesleria

At a glance

Occurrence records4 868

Data sources10

Biological traits13

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Sesleria argentea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 868 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF4 868 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT4.4 Gbp

01Narrative

Sesleria argentea is a species of perennial grass in the family Poaceae. It is 35 – long with a 0.5 – long ciliolate membrane. Its leaves are either conduplicate or convolute, and are 10 – long and 3 – wide. It also has a linear panicle spiciform which is 3.5 – long and 0.5 – wide.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.282 m

Seed mass1.54 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Leaf n21.54 mg/g

Specific leaf area (SLA)22.18 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sesleria argentea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKP296114.1 ↗593 bpSpain

ACGT

GTGACCCTGACCAAAACAGACCGCGCACGCGTCATCTACCCCGCCGAGCGGCGGCATCGTTCGTCGCTCGGCCAAGTCCTCGACAACCTC …

Sesleria argentea voucher LEB<ESP>:F.Llamas,C.Acedo & A.Alonso 4.2009 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Sesleria argentea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 401 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Sesleria argentea4.4 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy4× tetraploid · measured

Chromosome records28–282n range28median28mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 288×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · fl-europaea +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).

CCDB · iber-fl — Recherches sur les liens de parent entre la flore orophile des Alpes et celledes Pyrnes. Kpfer, P.Boissiera23: 3-322(1974).

CCDB · fl-europaea — LOve & Kjellqvist

CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.

CCDB · book-fedorov — AB):IYJIOB 1931

CCDB · book-fedorov — Guinochet, Logeois 1962

CCDB · book-fedorov — Ujhelyi 1960b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 868 records

Wild obs. + sensor4 576

Museum / vouchered292

Range

Area of Occupancy AOO3 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 139≤1 km 221≤10 km 3 811>10 km 118

4 289 georeferenced · 287 without coordinates

Open the mapobservation + sensor4 576

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 2≤1 km 50≤10 km 25

77 georeferenced · 215 without coordinates

Open the institutions mapphysical evidence292

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	174
Universidad del Pais Vasco (UPV/EHU)location not on record	26
MAlocation not on record	17
BClocation not on record	9
Barcelona, ES	9
Entomological Society of Latvialocation not on record	8
València, ES	7
Institut und Museum fuer Geologie und Palaeontologielocation not on record	6
Sevilla, ES	5
Dresden, DE	4
Phyletisches Museum Jenalocation not on record	3
Pamplona, ES	2
Granada, ES	2
Pamplona, ES	2
Madrid, ES	2
Salamanca, ES	2
Auckland, NZ	1
Bourges, FR	1
Oskarshamn, SE	1
Zürich, CH	1

20 institutions · 282 of 292 vouchered records shown · 10 without an institution code

09Environmental DNA1 detections

Where the DNA of Sesleria argentea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sesleria argentea

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction3

Diet & foraging1

Habitat & environment5

Physiology & chemistry2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type4 868 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type4 868 records