Sesbania sesban
(L.) Merr. · speciesAt a glance
Occurrence records2 201
Data sources14
Biological traits43
DNA specimens10
eDNA detections11
Sources14 archives
Databases and archives Sesbania sesban's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 201 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics10 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources43 traits
Chemical compositionLOTUS1 compounds
Occurrence & distributionGBIF2 201 records
Environmental DNA1 datasets · 5 countries11 detections
DNA & barcodingBOLD · NCBI10 specimens
Genome at a glanceCCDB · GIFT2n = 12
01Narrative
Sesbania sesban, the Egyptian riverhemp, is a species of plant in the legume family. Synonyms include: Aeschynomene aegyptiaca (Pers.) Steud. Aeschynomene sesban L. Emerus sesban (L.) Kuntze Sesbania aegyptiaca Poir.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology17
Fruit length max230 mm
Fruit length min100 mm
Fruit width max4 mm
Fruit width min3 mm
Leaf length max20 mm
Leaf length min15 mm
Leaf width max10 mm
Leaf width min5 mm
Plant height5 m
Plant height max7 m
Plant height min1 m
Seed length max4 mm
Seed mass13.87 mg
⚠ sources differ — TRY: 13.87 mg · GIFT: 11.47 mg
Seed mass max47.01 mg
Seed mass min7.05 mg
Seed width max3 mm
Seed width min2 mm
Life cycle & reproduction8
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeself
Life formshrub or tree
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit typelegume
Growth formshrub
Habitat GIFTÁrea Antrópica
Mycorrhiza typenon-ectomycorrhizal
Woodinesswoody
Physiology & chemistry5
Leaf n25.5 mg/g
Leaf p2.9 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Wood density430 mg/cm³
Other traits1
Plant support typefree-standing
03Chemical composition1 compounds
Compounds documented for Sesbania sesban across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Pyridine alkaloids1
Documented compounds1 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Trigonelline | present | LOTUS |
05DNA & barcoding10 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sesbania sesban has left across the world's sequence archives.
At a glance
DNA specimens10
Marker genes5
GenBank sequences10
eDNA detections11
Countries5
The DNA barcodea real sequence read deposited for this species
ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTCAAAAGCAATCTGACCCGTGAACTCGTTAGCAACACATCCACC …
Sesbania sesban isolate leaves small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Sesbania sesban carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 12 n = 6
Ploidydiploid inferred
Chromosome records12–242n range12median12mode38records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1234×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +4
CCDB · book-ipcn65 — Tixier 1965
CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.
CCDB · ipcn-api-dl — Jahan, B., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in some taxa of Fabaceae mostly native to Pakistan. Ann. Missouri Bot. Gard. 81: 792–799.
CCDB · ipcn-api-dl — Abou-El-Enain, M. M., H. H. El-Shazly & M. A. El-Kholy. 1998. Karyological studies in some African species of the genus Sesbania (Fabaceae). Cytologia 63: 1–8.
CCDB · ipcn-api-dl — Forni-Martins, E. R. & M. Guerra. 1999. Longitudinal differentiation in chromosomes of some Sesbania Scop. species (Fabaceae). Caryologia 52: 97–103.
CCDB · ipcn-api-dl — Mohamed, M. K. 1997. Chromosome counts in some flowering plants from Egypt. Egypt. J. Bot. 37(2): 129–156.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1979. Cytological evolution of the leguminous flora of the Punjab plain. Recent Res. Pl. Sci. (New Delhi). 7: 252–260.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1985. Chromosomal studies on the Indian legumes. In: V. R. Reddi & M. K. Rao (editors), Cytogenetics of Higher Plants: Chromosome Structure and Behaviour. pp. 39–41.
CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.
CCDB · ipcn-api-dl — Vijayakumar, M. G. & P. I. Kuriachan. 1995. Karyomorphology of five taxa of Sesbania from south India. Caryologia 48(3–4): 329–334.
CCDB · ipcn-api-dl — Bir, S. S., M. Sidhu & K. Talwar. 1975. Cytological observations on genus Sesbania from the Punjab Plazin (North India). New Bot. 2: 101–108.
CCDB · ipcn-api-dl — Sareen, T. S. & R. TREHAN. 1976. In IOPB chromosome number reports LIV. Taxon 25: 631–649.
CCDB · ipcn-api-dl — Salimuddin & B. Ramesh. 1993. Karyological studies in the genus Sesbania. Cytologia 58: 241–246.
CCDB · book-ipcn75-78 — Sareen & Trehan 1976
CCDB · book-indian_vol1 — Jacob, K.T. 1941 (Turner, B.L. 1955); Pawar, M.S. & Kulkarni, S.A. 1955 ; Bir, S.S. & Sidhu, S. 1966; Datta, R.M. & Neogi, A.K. 1970; AI~Mayah, A .-R .A. & Al-Shehbaz, I. 1977
CCDB · book-indian_vol1 — Haque, A. 1946 ; Rao, Y.S. 1946 ; Berger, C.A. et al. 1958 ; Baquar, S.R. et at. 1965
CCDB · book-indian_vol1 — Sareen, T.S. & Trehan, R. 1976 ; Bir S.S. & Kumari, S. 1980
CCDB · book-indian_vol1 — Bir, S.S. & Sidhu, S. 1967; Sareen T.S. & Trehan, R. 1976; Bir, S.S. & Kumari, S. 1980
CCDB · book-indian_vol1 — Bir, S.S. & Kumari, S. 1980
CCDB · book-fedorov — Haque 1946
CCDB · book-fedorov — Rao Y. S. 1946
CCDB · book-fedorov — Berger C. A. et al. 1958 c
CCDB · book-fedorov — BaiJuar et al. 1965
CCDB · book-fedorov — Frahm-Leliveld 1953, 1957 t
CCDB · book-fedorov — Jacob 1941 (Turner 1955)
CCDB · book-fedorov — Pawar, Kulkarni 1955
CCDB · book-fedorov — Bir, Sidhu (C. n. VI. 1966) s
CCDB · book-atlas-flowering-plants — Rao 1946
CCDB · book-atlas-flowering-plants — Haque 1946
GIFT · GIFT (floras)
2n 142×CCDB · book-indian_vol1 · GIFT · GIFT (floras)
CCDB · book-indian_vol1 — Sarkar, A.K., Datta, N. et al.1978
GIFT · GIFT (floras)
2n 161×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 241×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Joshua, D. C. & C. R. Bhatia. 1989. Karyotype analysis in Sesbania species. Nucleus (Calcutta) 32: 161–163.
n 67×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · book-ipcn65 — Baquar et al. 1965
CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.
CCDB · ipcn-api-dl — Jahan, B., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in some taxa of Fabaceae mostly native to Pakistan. Ann. Missouri Bot. Gard. 81: 792–799.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1979. Cytological evolution of the leguminous flora of the Punjab plain. Recent Res. Pl. Sci. (New Delhi). 7: 252–260.
CCDB · ipcn-api-dl — AL-MAYAH, A. R. A. & I. A. Al-Shehbaz. 1977. Chromosome numbers for some Leguminosae from Iraq. Bot. Not. 130: 437–440.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn75-78 — Al-Mayah
n 72×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1978. Chromosomes and adaptation of some araceous members. Cell Chromosome Newslett. 1: 28.
CCDB · book-ipcn75-78 — Sarkar et al. 1978
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 201 records
Wild obs. + sensor1 225
Museum / vouchered526
Cultivated / captive52
Other398
Origin
Native7
Introduced23
Range
Area of Occupancy AOO3 324 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy94% within 1 km
≤100 m 207≤1 km 15≤10 km 2>10 km 11
235 georeferenced · 990 without coordinates
Open the mapobservation + sensor1 225
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy31% within 1 km
≤100 m 10≤1 km 11≤10 km 38>10 km 9
68 georeferenced · 458 without coordinates
Open the institutions mapphysical evidence526
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 52 records without
Open the mapnot free-living52
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions42 of 85 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Kew, GB | 67 |
| MeiseBGlocation not on record | 38 |
| Saint Louis, US | 35 |
| Taipei, TW | 32 |
| Bronx, US | 16 |
| Museo Entomologico de Leonlocation not on record | 13 |
| Taipei, TW | 10 |
| University of Stellenboschlocation not on record | 10 |
| LDlocation not on record | 8 |
| Yaoundé, CM | 7 |
| Beijing, CN | 7 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| Xiamen, CN | 6 |
| TAIElocation not on record | 5 |
| Paris, FR | 5 |
| South Kensington, GB | 4 |
| Frankfurt am Main | 4 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 4 |
| Ivano-Frankivsk, UA | 4 |
| TAFORI-LSRClocation not on record | 4 |
| Dehra Dun, IN | 3 |
| HNBlocation not on record | 3 |
| Pretoria, ZA | 3 |
| Dresden, DE | 2 |
| Bern, CH | 2 |
| Baroda, IN | 2 |
| Leiden University Medical Centerlocation not on record | 2 |
| MAlocation not on record | 2 |
| Kunming, CN | 2 |
| Guangzhou, CN | 2 |
| Mount Annan, AU | 2 |
| Brasília, BR | 2 |
| Tampa, US | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Canberra, AU | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| UNICAMPlocation not on record | 2 |
| Taipei, TW | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| Feira de Santana, BR | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Guangzhou, CN | 2 |
| Post Graduate College Bannulocation not on record | 1 |
| Nishihara, JP | 1 |
| Wlocation not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Instituto de Investigação Científica Tropicallocation not on record | 1 |
| UPNlocation not on record | 1 |
| Bratislava, SK | 1 |
| S. Bunma and H. Balslevlocation not on record | 1 |
| Porto Alegre, BR | 1 |
| UNIVASFlocation not on record | 1 |
| ASUlocation not on record | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Tempe, US | 1 |
| Chongqing Museumlocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| Nanjing, CN | 1 |
| National Museums of Kenyalocation not on record | 1 |
| Palmerston, AU | 1 |
| Helsinki, FI | 1 |
| Cenargenlocation not on record | 1 |
| Uppsala, SE | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| CNF-UFHBlocation not on record | 1 |
| Kochi, JP | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| CEPLAClocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Zürich, CH | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Philadelphia, US | 1 |
| Plocation not on record | 1 |
| Masindi, UG | 1 |
| Llocation not on record | 1 |
| Brisbane, AU | 1 |
| Claremont, US | 1 |
| Chicago, US | 1 |
| S. Bunma & H. Balslevlocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| James Cook Townsvillelocation not on record | 1 |
| Stockholm, SE | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
85 institutions · 381 of 526 vouchered records shown · 144 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA11 detections
Where the DNA of Sesbania sesban was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median20.7 °C 11.3–27.1
Seasonal swing summer↔winter13.2 °C
Max temp (day)27.8 °C 15.9–32.9
Min temp (night)13.9 °C 7.40–20.4
Precipitation50.7 mm/mo 13.2–76.7
Air humidity48.5 % 40.9–60.6
Moisture balance-97.8 mm/mo -188–-19.7
Vapour deficit1,339 Pa 610–2,115
Wind speed4.20 m/s 2.90–5.50
Cloud cover33.0 % 24.3–44.7
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.