Sesamum radiatum

Schumach. & Thonn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Pedaliaceae/Sesamum

At a glance

Occurrence records551

Data sources9

Biological traits18

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Sesamum radiatum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility551 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS16 compounds

Occurrence & distributionGBIF551 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT · NCBI1.1 Gbp

01Narrative

Sesamum radiatum is a species of flowering plant in the Pedaliaceae. It is in the same genus as sesame. It is known by the English common names benniseed, black benniseed, black sesame,Konan, A. B., et al. (2011). Myostimulating effect of Sesamum radiatum aqueous leaf extract in isolated guinea-pig taenia caeci contractile activity. Afr J Tradit Complement Altern Med. 8(4): 377–385. and vegetable sesame.B.M. Auwalu and F.E. Babatunde. (2007). Analyses of growth, yield and fertilization of vegetable sesame (Sesamum radiatum Schum). Journal of Plant Sciences 2: 108-112. It is native to west and central Africa, has been cultivated since ancient times in Africa, and is sometimes also used in tropical Asia where it has become naturalized to a small extent.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height0.805 m

⚠ sources differ — GIFT: 0.805 m · TRY: 1 m

Plant height max1.2 m

Seed mass1.79 mg

Seed mass max1.85 mg

Seed mass min1.85 mg

Life cycle & reproduction4

Life formannual or shrub

Life spanannual

Raunkiær life formtherophyte

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTopen vegetation

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition16 compounds

Compounds documented for Sesamum radiatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Stigmastane steroids3

Ergostane steroids $ Stigmastane steroids2

Furofuranoid lignans2

Cholestane steroids1

Cycloartane triterpenoids $ Lanostane, Tirucallane and Euphane triterpenoids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
24-Methylenecycloartan-3-ol	present	LOTUS
24-Methylenelophenol	present	LOTUS
5-Dehydroavenasterol	present	LOTUS
Alpha-Amyrin	present	LOTUS
avenasterol	present	LOTUS
beta-Amyrin	present	LOTUS
beta-Sitosterol	present	LOTUS
Campesterol	present	LOTUS
Cholesterol	present	LOTUS
Citrostadienol	present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sesamum radiatum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSOM746325.1 ↗638 bp

ACGT

ATGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAAGCAGACCGCGAACACGTTGCCAACAAAATCGG …

Sesamum radiatum voucher Zhigila208 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Sesamum radiatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 138 147 500 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sesamum radiatum1.14 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Ploidy8× octoploid · measured

Chromosome records32–642n range64median64mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 644×GoaT · Kew Plant DNA C-values Database · CCDB · book-atlas-flowering-plants · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-atlas-flowering-plants — John & R. 1941 ov " Africa

CCDB · kew — Hiremath SC, Patil CG, Ksheerasagar AL. (pers. comm. 2001).

2n 321×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ihlenfeldt, H. D. & U. Grabow-Seidensticker. 1979. The genus Sesamum L. and the origin of the cultivated Sesame. In G. Kunkel (editor) Taxonomic Aspects of African Economic Botany. 53–60. Excmo, Las Palmas de Gran Canaria. In Tax. Aspects Afr. Econ. Bot. Royal Botanical Gardens, Richmond.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

octoploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type551 records

Wild obs. + sensor148

Museum / vouchered296

Other107

Origin

Native2

Range

Area of Occupancy AOO1 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 21≤1 km 6≤10 km 6>10 km 3

36 georeferenced · 112 without coordinates

Open the mapobservation + sensor148

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 2≤10 km 2>10 km 1

6 georeferenced · 290 without coordinates

Open the institutions mapphysical evidence296

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	46
Yaoundé, CM	25
HNBlocation not on record	25
Adam Mickiewicz University in Poznańlocation not on record	11
CNF-UFHBlocation not on record	8
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	7
LBVlocation not on record	4
Stockholm, SE	4
Paris, FR	4
Herbier National du Gabonlocation not on record	4
Frankfurt am Main	4
University of Stellenboschlocation not on record	4
Brussels, BE	3
Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record	3
Claremont, US	2
Université du Lomélocation not on record	2
Dresden, DE	2
MAlocation not on record	2
Leiden University Medical Centerlocation not on record	1
Bronx, US	1
EL PASO, US	1
South Kensington, GB	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
Chongqing Museumlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
University of Hamburglocation not on record	1

26 institutions · 168 of 296 vouchered records shown · 128 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)