Sesamothamnus lugardii

N.E.Br. ex Stapf · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Pedaliaceae/Sesamothamnus

At a glance

Occurrence records160

Data sources7

Biological traits17

DNA specimens5

eDNA detections4

Sources7 archives

Databases and archives Sesamothamnus lugardii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF160 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Карамба — вид рослин порядку губоцвіті.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height1 m

Plant height max5 m

Plant height min1.2 m

Seed mass16.73 mg

Seed mass max18.05 mg

Seed mass min15.4 mg

Life cycle & reproduction2

Life formcaudex shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 220 m

Elevation min180 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub

Woodinesswoody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sesamothamnus lugardii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences6

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM746329.1 ↗616 bp

ACGT

TGCAAACTGCAAAACAAGACCGCGAACACGTGATTAACAAAATCGGGGACTTGGCGCGGGGGAACCCCCCGCCTCGGCCCCTCCCCCGCC …

Sesamothamnus lugardii voucher Zhigila1337 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type160 records

Wild obs. + sensor93

Museum / vouchered67

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 53≤1 km 4≤10 km 5>10 km 4

66 georeferenced · 27 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	49
Kew, GB	5
MSB-3054location not on record	1
South African National Biodiversity Institutelocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1

5 institutions · 57 of 67 vouchered records shown · 10 without an institution code

09Environmental DNA4 detections

Where the DNA of Sesamothamnus lugardii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 24.8–24.8

Seasonal swing summer↔winter9.30 °C

Max temp (day)30.2 °C

Min temp (night)18.5 °C

Precipitation26.4 mm/mo

Air humidity52.0 %

Moisture balance-131 mm/mo

Vapour deficit1,505 Pa

Wind speed3.60 m/s

Cloud cover14.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)