Sesamia calamistis

Hampson, 1910 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Sesamia

At a glance

Occurrence records38

Data sources8

Biological traits0

DNA specimens51

eDNA detections50

Sources8 archives

Databases and archives Sesamia calamistis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.96 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF38 records

Environmental DNA1 datasets · 7 countries50 detections

DNA & barcodingBOLD51 specimens

Genome at a glanceGoaT958 Mbp

01Narrative

Sesamia calamistis, the African pink stem borer, is a moth of the family Noctuidae.Tams, W.H.T. & J. Bowden, 1953: A Revision of the African Species of Sesamia Guenée and related Genera (Agrotidae-Lepidoptera). Bulletin of Entomological Research 43 (4): 645–678. It is distributed throughout sub-Saharan Africa and on Indian Ocean islands. The larvae are agricultural pests that affect rice, maize, sorghum, and sugarcane crops. They have been recorded feeding on pearl millet and other grass species crops in the Ivory Coast and other parts of West Africa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sesamia calamistis has left across the world's sequence archives.

At a glance

DNA specimens51

BINs2

Marker genes2

eDNA detections50

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

31Amostly conserved

55Tmostly conserved

56Tmostly conserved

76Amostly conserved

88Cmostly conserved

127Cmostly conserved

181Avariable

193Cmostly conserved

217Avariable

220Amostly conserved

235Tvariable

263Tmostly conserved

271Cmostly conserved

304Cvariable

313Cmostly conserved

316Amostly conserved

319Amostly conserved

337Amostly conserved

340Tvariable

361Tmostly conserved

370Gvariable

379Amostly conserved

400Tmostly conserved

406Tvariable

415Gmostly conserved

428Tmostly conserved

436Amostly conserved

477Gmostly conserved

478Tvariable

479Cmostly conserved

487Cvariable

499Cmostly conserved

500Cmostly conserved

505Cmostly conserved

511Gmostly conserved

529Cmostly conserved

547Tmostly conserved

553Tmostly conserved

562Gmostly conserved

568Tvariable

578Tmostly conserved

586Amostly conserved

604Tmostly conserved

631Amostly conserved

646Tmostly conserved

658Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGAACTCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes19

BINs2

Most divergent pair6.5%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sesamia firmatasame genus5.3%Sesamia pennipunctasame genus5.6%Sesamia congoensissame genus5.6%Sesamia poephagasame genus6.1%Sesamia epunctiferasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Sesamia calamistis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size958 440 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sesamia calamistis0.96 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type38 records

Wild obs. + sensor6

Museum / vouchered32

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 32 records without

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	22
ZSMlocation not on record	3
The University of the West Indies, Trinidad and Tobagolocation not on record	1

3 institutions · 26 of 32 vouchered records shown · 6 without an institution code

09Environmental DNA50 detections

Where the DNA of Sesamia calamistis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map7 countries0

Mopane/Bushwillow Woodlands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 19.6–26.3

Seasonal swing summer↔winter3.60 °C

Max temp (day)27.9 °C 23.1–30.4

Min temp (night)19.0 °C 15.9–24.2

Precipitation115 mm/mo 34.4–292

Air humidity63.0 % 52.5–67.1

Moisture balance-27.2 mm/mo -121–193

Vapour deficit1,105 Pa 810–1,452

Wind speed2.70 m/s 1.70–4.60

Cloud cover27.8 % 17.1–40.2

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)