Serruria fasciflora

Knight · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Serruria

At a glance

Occurrence records2 658

Data sources7

Biological traits23

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Serruria fasciflora's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 658 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF2 658 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Serruria fasciflora or common pin spiderhead is a species of flowering plant in the family Proteaceae. It is a sprawling to upright shrublet of 40 cm to 1 m (1–3 ft) high and about m (1 ft) wide. It has finely divided, upward curving leaves with thread-thin segments and clusters of sweetly scented heads, each consisting of five to seven silvery pink flowers, that may be found year-round, but mostly from May to December. It is a rather widespread and common species, that is restricted to the south of the Western Cape province of South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max1 m

Plant height min0.5 m

Seed mass6.08 mg

Seed mass max5.8 mg

Seed mass min5.8 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Elevation min30 m

Epiphyteterrestrial

Growth formshrub

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry4

Leaf n8.22 mg/g

Leaf p0.158 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)3.91 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Serruria fasciflora has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKP110477.1 ↗552 bpSouth Africa · 2012

ACGT

AGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Serruria fasciflora ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa

plant barcode

08Occurrence & distribution

Record type2 658 records

Wild obs. + sensor2 118

Museum / vouchered540

Range

Area of Occupancy AOO2 500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 770≤1 km 136≤10 km 27>10 km 7

1 940 georeferenced · 178 without coordinates

Open the mapobservation + sensor2 118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 7

10 georeferenced · 530 without coordinates

Open the institutions mapphysical evidence540

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	259
Pretoria, ZA	202
Cape Town, ZA	40
Philadelphia, US	10
Paris, FR	7
MSB-3054location not on record	5
GHPG$location not on record	3
Saint Louis, US	3
South African National Biodiversity Institutelocation not on record	2
South African Environmental Observations Networklocation not on record	1
Stockholm, SE	1
STUlocation not on record	1

12 institutions · 534 of 540 vouchered records shown · 6 without an institution code

09Environmental DNA2 detections

Where the DNA of Serruria fasciflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 10.8–10.8

Seasonal swing summer↔winter9.90 °C

Max temp (day)17.1 °C

Min temp (night)4.90 °C

Precipitation34.4 mm/mo

Air humidity54.6 %

Moisture balance-33.3 mm/mo

Vapour deficit585 Pa

Wind speed3.60 m/s

Cloud cover7.10 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Serruria fasciflora

At a glance

Sources7 archives

Size & morphology5

Life cycle & reproduction3

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Other traits1

At a glance

Record type2 658 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 658 records