Serratula coronata

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Serratula

At a glance

Occurrence records2 854

Data sources10

Biological traits24

DNA specimens7

eDNA detections7

Sources10 archives

Databases and archives Serratula coronata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 854 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Chemical compositionNPASS1 compounds

Occurrence & distributionGBIF2 854 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Серпі́й уві́нчаний — багаторічна трав'яниста рослина родини айстрових (складноцвітих). Серпій увінчаний росте на сухих луках, по узліссях, серед чагарників.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Fruit width2 mm

Fruit width max2 mm

Fruit width min2 mm

Plant height max1.5 m

Plant height min0.35 m

Life cycle & reproduction6

Dispersal typewind

Flowering endSep

Flowering startJun

Life formperennial or rhizomatous geophyte

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 600 m

Elevation mean865 m

Elevation min130 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, forest edges, meadows, meadows: wet, mountains, shrubberies, steppe

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition1 compounds

Compounds documented for Serratula coronata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pulvinones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Pulvinic acid dilactone		present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Serratula coronata has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections7

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ302261.1 ↗628 bpKazakhstan

ACGT

AGGATCATTGTCGAAGCCTGCACAGCAGAACGACCCGTGAACATGTAATCACAACCGGGTGTCGTGGGATCGGGTGAGAGCCTTAGTCCT …

Serratula coronata voucher ALT23-356 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Serratula coronata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–242n range22median22mode18records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2217×CCDB · iapt · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +3

CCDB · iapt — IAPT/IOPB Chromosome Data 13

CCDB · book-ipcn65 — Arano 1965

CCDB · ipcn-api-dl — Pulkina, S. V. 1988. Chromosome numbers in some species of the Asteraceae. Bot. Žhurn. (Moscow & Leningrad) 73: 607–608.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1983. Chromosome numbers of some species of the family Asteraceae II. Bot. Zhurn. SSSR 68(5): 660–664. (In Russian).

CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1989. Chromosome numbers in representatives of some families of the flora of the Soviet far east. Bot. Žhurn. (Moscow & Leningrad) 74: 1810–1811.

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.

CCDB · ipcn-api-dl — Tonian, T. R. 1980. Relation between chromosome number and some morphological features of Centaureinae Less representatives. Rev. Biol. 33 (5): 552–554.

CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1990. Chromosome numbers in some representatives of the families Asclepiadaceae, Asteraceae, Boraginaceae, Chenopodiaceae, Lamiaceae, Oleaceae, Onagraceae, Scrophulariaceae, Solanaceae, Urticaceae from the Soviet Far East. Bot. Žhurn. (Moscow & Leningrad) 75: 1619–1622.

CCDB · ipcn-api-dl — Volkova, S. A., E. V. Boyko & I. G. Gavrilenko. 1999. Chromosome numbers in the representatives of some families of the Primorye territory flora. Bot. Žhurn. (Moscow & Leningrad) 84(2): 140–141.

CCDB · ipcn-api-dl — Probatova. 2005. Chromosome numbers of some dicotyledons of the flora of the Amur Region. Bot. Žhurn. (Moscow & Leningrad) 90(5): 779–792.

CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.

CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. Data on karyology of the family Compositae Giseke. Citologija 10: 198-206.

CCDB · eflora

CCDB · book-fedorov — Arano 1964a, 19135

CCDB · book-fedorov — XyKcanona 11 liP

CCDB · iapt — IAPT/IOPB Chromosome Data 20

2n 241×CCDB · book-fedorov

CCDB · book-fedorov — Tarnavschi. 1938

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 854 records

Wild obs. + sensor2 308

Museum / vouchered546

Origin

Native3

Introduced1

Range

Area of Occupancy AOO7 552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 893≤1 km 199≤10 km 99>10 km 314

1 505 georeferenced · 803 without coordinates

Open the mapobservation + sensor2 308

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 6≤1 km 29≤10 km 71>10 km 11

117 georeferenced · 429 without coordinates

Open the institutions mapphysical evidence546

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	226
Institute of Applied Ecology, Academia Sinicalocation not on record	88
Beijing, CN	55
Yangling, CN	28
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	23
Servico de Microbiologia e Imunologialocation not on record	14
Urumqi, CN	8
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	8
Inner Mongolia Universitylocation not on record	7
BRNUlocation not on record	6
ENTClocation not on record	6
Jiangxi College of Educationlocation not on record	5
Nanjing, CN	5
Bronx, US	4
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	4
Xian, CN	3
Frankfurt am Main	2
The State Museum-Preserve "The Kulikovo pole"location not on record	2
Shinshu Universitylocation not on record	2
Berlin, DE	2
Wuhan, CN	2
Chengdu, CN	2
Peking Universitylocation not on record	2
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	2
Guilin, CN	2
IWEP FEB RASlocation not on record	2
Bando, JP	2
Samara National Research Universitylocation not on record	1
National Institute of Biological Resourceslocation not on record	1
Guangzhou, CN	1
Zhejiang Universitylocation not on record	1
Beijing, CN	1
Burlington, US	1
Zhengzhou, CN	1
WNNUlocation not on record	1
Tianjin Natural History Museumlocation not on record	1
Philadelphia, US	1

37 institutions · 522 of 546 vouchered records shown · 23 without an institution code

09Environmental DNA7 detections

Where the DNA of Serratula coronata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.00 °C 7.00–7.00

Seasonal swing summer↔winter19.8 °C

Max temp (day)11.2 °C

Min temp (night)2.10 °C

Precipitation170 mm/mo

Air humidity64.0 %

Moisture balance100 mm/mo

Vapour deficit403 Pa

Wind speed2.60 m/s

Cloud cover44.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Serratula coronata

At a glance

Sources10 archives

Size & morphology5

Life cycle & reproduction6

Diet & foraging1

Habitat & environment11

Physiology & chemistry1

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 854 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 854 records