Septoria scabiosicola

Desm. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Septoria

At a glance

Occurrence records336

Data sources8

Biological traits0

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Septoria scabiosicola's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF336 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Septoria scabiosicola Desm. – gatunek grzybów z klasy Dothideomycetes. Grzyb mikroskopijny pasożytujący na niektórych gatunkach roślin z rodziny szczeciowatych (Dipsacaceae). Powoduje u nich plamistość liści.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Septoria scabiosicola has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences10

eDNA detections7

Countries4

The DNA barcodea real sequence read deposited for this species

ITSKF251538.1 ↗495 bpAustria

ACGT

GCGGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGT …

Septoria scabiosicola strain CBS 109093 culture-collection CBS:109093 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type336 records

Wild obs. + sensor207

Museum / vouchered128

Other1

Range

Area of Occupancy AOO996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 95≤1 km 18≤10 km 49>10 km 1

163 georeferenced · 44 without coordinates

Open the mapobservation + sensor207

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 2≤1 km 11≤10 km 37>10 km 25

75 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	36
Helsinki, FI	18
Tartu, EE	14
LDlocation not on record	11
DPIlocation not on record	8
Karlsruhe, DE	6
WU-MYClocation not on record	6
Kew, GB	5
Museo Entomologico de Leonlocation not on record	4
Görlitz, DE	4
Chicago, US	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Mlocation not on record	1
BDBClocation not on record	1
TROMlocation not on record	1
CABI Bioscience Genetic Resource Collectionlocation not on record	1
Auckland, NZ	1
Canberra, AU	1

18 institutions · 124 of 128 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Septoria scabiosicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 10.1–10.1

Seasonal swing summer↔winter15.0 °C

Max temp (day)13.4 °C

Min temp (night)6.70 °C

Precipitation73.8 mm/mo

Air humidity63.8 %

Moisture balance-1.10 mm/mo

Vapour deficit487 Pa

Wind speed5.10 m/s

Cloud cover44.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)