Sepia hierredda

Rang, 1835 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Sepiida/Sepiidae/Sepia

At a glance

Occurrence records40

Data sources9

Biological traits7

DNA specimens14

eDNA detections16

Sources9 archives

Databases and archives Sepia hierredda's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

OBISOcean Biodiversity Information System3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS40 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD14 specimens

01Narrative

Sepia hierredda, the giant African cuttlefish, is a species of cuttlefish from the family Sepiidae, which was previously considered conspecific with the common cuttlefish Sepia officinalis. It is found along the western coast of Africa and is an important species to fisheries.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology2

Body length50 cm

Body mass7 500 g

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max50 m

Depth min1 m

Vulnerability40

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sepia hierredda has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P626 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

28Amostly conserved

29Gmostly conserved

30Amostly conserved

31Gmostly conserved

32Amostly conserved

33Gmostly conserved

34Tmostly conserved

35Tmostly conserved

36Amostly conserved

37Gmostly conserved

38Gmostly conserved

39Tmostly conserved

40Amostly conserved

41Amostly conserved

42Amostly conserved

43Cmostly conserved

44Cmostly conserved

46Gmostly conserved

47Gmostly conserved

48Tmostly conserved

49Amostly conserved

50Cmostly conserved

51Amostly conserved

52Cmostly conserved

54Tmostly conserved

55Tmostly conserved

56Tmostly conserved

57Amostly conserved

58Amostly conserved

129Cmostly conserved

135Gmostly conserved

141Amostly conserved

144Gvariable

160Gmostly conserved

192Tmostly conserved

276Gmostly conserved

476Tmostly conserved

597Cvariable

606Cmostly conserved

GGTACTTCATTAAGATTAATAATTCGAAGAGAGTTAGGTAAACCTGGTACACTTTTAAATGATGATCAACTTTACAACGTAGTAGTAACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes8

BIN1

Most divergent pair0.80%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sepia berthelotisame genus12.0%Sepia officinalissame genus12.7%Sepiella inermissame family13.6%Rhombosepion eleganssame family14.7%Bathyteuthis abyssicolasame order15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type40 records

Wild obs. + sensor13

Museum / vouchered27

Range

Area of Occupancy AOO124 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 62 m · max 114.5 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 4≤1 km 8≤10 km 1

13 georeferenced

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 16>10 km 2

18 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museu Nacional de História Natural e da Ciêncialocation not on record	14
UM-RSMASlocation not on record	6
Natural History Museum Rotterdamlocation not on record	3
Cambridge, US	1

4 institutions · 24 of 27 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Sepia hierredda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–14.5

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C

Min temp (night)9.30 °C

Precipitation72.2 mm/mo

Air humidity58.3 %

Moisture balance-20.6 mm/mo

Vapour deficit782 Pa

Wind speed2.60 m/s

Cloud cover40.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)