Sepedon spinipes

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Sciomyzidae/Sepedon

At a glance

Occurrence records2 932

Data sources7

Biological traits2

DNA specimens15

eDNA detections20

Sources7 archives

Databases and archives Sepedon spinipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 932 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 932 records

Environmental DNA2 datasets · 7 countries20 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceTreeOfSex2n = 12

01Narrative

Sepedon spinipes is a species of fly (insects in the family Sciomyzidae). It is found in the PalearcticFauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi.Séguy, E. (1934) Diptères: Brachycères. II. Muscidae acalypterae, Scatophagidae. Paris: Éditions Faune de France 28 (FdeFr28)Dipt.Brachyceres.pdf Bibliotheque Virtuelle Numerique pdf

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)saprophagous

Feeding guild (larval)parasitoid

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sepedon spinipes has left across the world's sequence archives.

At a glance

DNA specimens15

BINs2

Marker genes1

eDNA detections20

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 66 variable positions, in barcode order

10Tmostly conserved

13Tmostly conserved

19Tmostly conserved

40Tmostly conserved

50Tmostly conserved

52Amostly conserved

58Gmostly conserved

61Tmostly conserved

85Cmostly conserved

103Tmostly conserved

133Cmostly conserved

136Tmostly conserved

142Cmostly conserved

157Tmostly conserved

166Gmostly conserved

169Tmostly conserved

172Cmostly conserved

178Tmostly conserved

202Tmostly conserved

208Amostly conserved

212Tmostly conserved

214Amostly conserved

232Amostly conserved

235Tmostly conserved

241Gmostly conserved

244Amostly conserved

247Cmostly conserved

265Gmostly conserved

268Tmostly conserved

271Tmostly conserved

274Cmostly conserved

280Amostly conserved

313Cmostly conserved

340Cmostly conserved

358Tmostly conserved

370Amostly conserved

376Amostly conserved

379Amostly conserved

406Cmostly conserved

445Tmostly conserved

454Cmostly conserved

472Cmostly conserved

484Amostly conserved

490Tmostly conserved

508Amostly conserved

520Tmostly conserved

529Cmostly conserved

535Tmostly conserved

541Amostly conserved

544Gmostly conserved

550Tmostly conserved

553Tmostly conserved

556Amostly conserved

565Amostly conserved

568Tmostly conserved

577Amostly conserved

604Amostly conserved

607Tmostly conserved

610Cmostly conserved

616Tmostly conserved

622Amostly conserved

625Amostly conserved

628Tmostly conserved

637Amostly conserved

646Cmostly conserved

653Cmostly conserved

AACTTTATATTTTATTTTTGGAGCTTGAGCAGGAATAGTTGGAACATCTTTAAGAATGCTTATTCGAGCTGAACTTGGTCATCCCGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes5

BINs2

Most divergent pair9.9%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sepedon americanasame genus7.4%Drosophila barbaraesame order14.6%Drosophila mayrisame order15.2%Minilimosina zedasame order15.2%Callicera auratasame order15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceTreeOfSex

The complete instruction manual Sepedon spinipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 121×TreeOfSex · invert

TreeOfSex · invert — Boyes, J., L. Knutson, K. Jan and C. Berg (1969). "Cytotaxonomic studies of Sciomyzidae (Diptera: Acalyptratae)." Transactions of the American Microscopical Society 88: 331-356. ↗

08Occurrence & distribution

Record type2 932 records

Wild obs. + sensor2 589

Museum / vouchered343

Range

Area of Occupancy AOO5 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 981≤1 km 390≤10 km 1 118

2 489 georeferenced · 100 without coordinates

Open the mapobservation + sensor2 589

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 103≤1 km 110≤10 km 42>10 km 3

258 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence343

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	64
Dipterist Forumlocation not on record	57
Gothenburg, SE	33
SLU Artdatabankenlocation not on record	29
Tilburg, NL	29
NHMOlocation not on record	26
SRS22021location not on record	16
DFFW1981location not on record	11
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	10
University of Tokyo, Department of Zoologylocation not on record	9
ZMAAlocation not on record	7
DFlocation not on record	5
NCMGlocation not on record	5
DFFW2016location not on record	4
Stockholm, SE	4
South Kensington, GB	4
CBDClocation not on record	2
neflocation not on record	2
DFFW2018location not on record	1
Copenhagen, DK	1
Ugentlocation not on record	1
Natural History Museum, Londonlocation not on record	1

22 institutions · 321 of 343 vouchered records shown · 22 without an institution code

09Environmental DNA20 detections

Where the DNA of Sepedon spinipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys2

Countries7

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 10.6–17.7

Seasonal swing summer↔winter19.5 °C

Max temp (day)15.2 °C 13.7–21.5

Min temp (night)9.40 °C 7.00–13.4

Precipitation55.4 mm/mo 40.3–81.4

Air humidity62.5 % 57.2–62.7

Moisture balance2.50 mm/mo

Vapour deficit519 Pa 477–833

Wind speed3.60 m/s

Cloud cover44.6 % 40.6–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sepedon spinipes

At a glance

Sources7 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 932 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 932 records