Sepedon sphegea

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Sciomyzidae/Sepedon

At a glance

Occurrence records5 076

Data sources9

Biological traits2

DNA specimens31

eDNA detections36

Sources9 archives

Databases and archives Sepedon sphegea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 076 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 076 records

Environmental DNA1 datasets · 6 countries36 detections

DNA & barcodingBOLD31 specimens

Genome at a glanceGoaT · TreeOfSex2n = 12

01Narrative

Sepedon sphegea is a PalearcticFauna Europaea species of fly in the family Sciomyzidae, the marsh flies or snail-killing flies.Séguy, E. (1934) Diptères: Brachycères. II. Muscidae acalypterae, Scatophagidae. Paris: Éditions Faune de France 28 (FdeFr28)Dipt.Brachyceres.pdf Bibliotheque Virtuelle Numerique pdfBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi. The larva feeds on aquatic snails and as an opportunist on other invertebrates.Lloyd Vernon Knutson and Jean-Claude Vala, 2011 Biology of Snail-Killing Sciomyzidae Flies Cambridge University PressNeff S. E. & Berg C. O. 1966. Biology and immature stages of malacophagous diptera of the genus Sepedon (Sciomyzidae). Virginia Agricultural Experiment Stations Bulletin, 566: 1-113. The habitat of this species includes among many others, pond margins and damp meadows. It has a particular fondness for Iris pseudacorus which grow at the edges of the pond. Adults can be found all year long but the main flight period is from March to October. ''Sepedon sphegea'' feeding on a larva of a dragonfly

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)saprophagous

Feeding guild (larval)parasitoid

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sepedon sphegea has left across the world's sequence archives.

At a glance

DNA specimens31

BINs2

Marker genes1

eDNA detections36

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 82 variable positions, in barcode order

1Amostly conserved

4Cmostly conserved

5Tmostly conserved

7Gmostly conserved

14Amostly conserved

19Tmostly conserved

22Ghighly variable

25Tmostly conserved

30Cmostly conserved

31Cvariable

40Avariable

43Amostly conserved

58Amostly conserved

61Avariable

70Tmostly conserved

76Avariable

79Avariable

82Cvariable

85Cvariable

91Avariable

100Avariable

103Tmostly conserved

106Cvariable

118Cvariable

127Avariable

133Tvariable

139Cvariable

148Avariable

169Tvariable

196Avariable

199Amostly conserved

205Avariable

206Tvariable

208Avariable

212Tvariable

214Avariable

235Cmostly conserved

238Tmostly conserved

244Gmostly conserved

265Tvariable

268Tmostly conserved

274Tvariable

286Cmostly conserved

301Tvariable

322Avariable

334Gvariable

352Tmostly conserved

367Tmostly conserved

373Avariable

385Tvariable

403Gvariable

412Avariable

415Avariable

424Tvariable

451Tvariable

463Tvariable

466Avariable

484Tvariable

493Avariable

499Avariable

500Cvariable

508Tvariable

514Avariable

520Avariable

526Tvariable

533Cvariable

535Cvariable

536Cmostly conserved

550Amostly conserved

559Tmostly conserved

562Avariable

565Avariable

571Cvariable

577Gvariable

586Tmostly conserved

613Cvariable

619Amostly conserved

625Avariable

640Tvariable

641Tvariable

653Tvariable

655Amostly conserved

AACCTTGTATTTTATTTTTGGGGCTTGAGCCGGAATAGTAGGAACATCATTAAGTATACTAATTCGTGCTGAACTAGGACACCCCGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.8%

Haplotypes13

BINs2

Most divergent pair2.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ischiolepta crenatasame order14.0%Phortica qingsongisame order14.0%Campichoeta griseolasame order14.2%Germaria angustatasame order14.3%Campichoeta obscuripennissame order14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Sepedon sphegea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records12–122n range12median12mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 124×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Boyes, J., L. Knutson, K. Jan and C. Berg (1969). "Cytotaxonomic studies of Sciomyzidae (Diptera: Acalyptratae)." Transactions of the American Microscopical Society 88: 331-356. ↗

08Occurrence & distribution

Record type5 076 records

Wild obs. + sensor4 705

Museum / vouchered371

Range

Area of Occupancy AOO9 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 1 462≤1 km 630≤10 km 2 257>10 km 16

4 365 georeferenced · 340 without coordinates

Open the mapobservation + sensor4 705

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 156≤1 km 104≤10 km 59>10 km 2

321 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence371

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Dipterist Forumlocation not on record	79
SRS22021location not on record	41
SLU Artdatabankenlocation not on record	33
Helsinki, FI	30
ZMAAlocation not on record	29
Gothenburg, SE	26
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	21
University of Tokyo, Department of Zoologylocation not on record	14
Tilburg, NL	11
NHMOlocation not on record	10
South Kensington, GB	9
DFFW2016location not on record	9
DFFW2018location not on record	4
NCMGlocation not on record	4
neflocation not on record	4
DFFW1981location not on record	3
CBDClocation not on record	3
DFlocation not on record	3
Natural History Museum, Londonlocation not on record	2
Stockholm, SE	2
MZLUlocation not on record	2
Washington, US	1
Philadelphia, US	1
Metsähallituslocation not on record	1
SGAV-and-NHMDlocation not on record	1
Essig Museum of Entomologylocation not on record	1

26 institutions · 344 of 371 vouchered records shown · 27 without an institution code

09Environmental DNA36 detections

Where the DNA of Sepedon sphegea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map6 countries0

3. Shrubland|3.5. Subtropical/Tropical Dry S…UrbanMediterranean chaparral8. Desert | 8.1. Hot Desert1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 10.3–28.9

Seasonal swing summer↔winter19.9 °C

Max temp (day)25.2 °C 13.8–33.9

Min temp (night)13.0 °C 5.40–23.3

Precipitation53.2 mm/mo 7.40–157

Air humidity55.9 % 48.5–63.7

Moisture balance-47.5 mm/mo -98.1–21.6

Vapour deficit1,063 Pa 504–1,569

Wind speed3.00 m/s 1.30–4.10

Cloud cover40.8 % 24.1–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sepedon sphegea

At a glance

Sources9 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 076 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 076 records