Senta flammea

Curtis, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Senta

At a glance

Occurrence records4 163

Data sources7

Biological traits2

DNA specimens14

eDNA detections14

Sources7 archives

Databases and archives Senta flammea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 163 records

Environmental DNA1 datasets · 5 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

The flame wainscot (Senta flammea) is a species of moth of the family Noctuidae. It is found from Europe and across the Palearctic to Japan, but is not found on the Iberian Peninsula, the islands in the Mediterranean Sea, Greece and central and southern Italy.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senta flammea has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections14

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

40Avariable

136Tmostly conserved

160Amostly conserved

181Amostly conserved

184Gmostly conserved

202Amostly conserved

220Tmostly conserved

226Tmostly conserved

247Tmostly conserved

274Cmostly conserved

287Cmostly conserved

340Cmostly conserved

352Cmostly conserved

364Tmostly conserved

370Gvariable

388Gmostly conserved

409Avariable

412Gmostly conserved

424Cmostly conserved

433Amostly conserved

445Tmostly conserved

448Cmostly conserved

463Cmostly conserved

477Gmostly conserved

500Tmostly conserved

517Amostly conserved

520Gmostly conserved

562Amostly conserved

574Tmostly conserved

641Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes5

BINs2

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polia purpurissatasame family5.8%Sideridis implexasame family5.9%Dasygaster pammachasame family6.1%Leucania obsoletasame family6.1%Leucania mergasame family6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 163 records

Wild obs. + sensor2 984

Museum / vouchered1 179

Origin

Native21

Range

Area of Occupancy AOO3 836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy19% within 1 km

≤100 m 320≤1 km 217≤10 km 2 296>10 km 9

2 842 georeferenced · 142 without coordinates

Open the mapobservation + sensor2 984

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 490≤1 km 99≤10 km 524>10 km 3

1 116 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence1 179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	1 073
Tartu, EE	33
SLU Artdatabankenlocation not on record	11
MZLUlocation not on record	9
Provincia di Livornolocation not on record	5
Tallinn, EE	5
Natural History Museum Rotterdamlocation not on record	5
National Institute of Biological Resourceslocation not on record	3
CBDClocation not on record	3
Philadelphia, US	3
NCMGlocation not on record	3
Nijmegen, NL	2
Zürich, CH	2
ЗМКУlocation not on record	1
Chiba, JP	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
ZSMlocation not on record	1
KOMlocation not on record	1
South Kensington, GB	1
Bando, JP	1

20 institutions · 1 164 of 1 179 vouchered records shown · 15 without an institution code

09Environmental DNA14 detections

Where the DNA of Senta flammea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 5.80–17.0

Seasonal swing summer↔winter19.8 °C

Max temp (day)16.7 °C 7.60–19.4

Min temp (night)9.20 °C 3.70–15.0

Precipitation66.6 mm/mo 58.7–129

Air humidity62.1 % 60.5–64.8

Moisture balance-46.2 mm/mo -81.4–23.8

Vapour deficit576 Pa 380–760

Wind speed3.90 m/s 1.70–5.70

Cloud cover37.7 % 35.9–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Senta flammea

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type4 163 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 163 records