Senecio vulgaris
speciesAt a glance
Occurrence records572 710
Data sources16
Biological traits151
DNA specimens85
eDNA detections44
Sources16 archives
Databases and archives Senecio vulgaris's data was compiled from.
WikipediaWikimedia Foundation16 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility572 710 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics85 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources151 traits
Chemical compositionLOTUS · NPASS59 compounds
Occurrence & distributionGBIF572 710 records
Environmental DNA1 datasets · 9 countries44 detections
DNA & barcodingBOLD · NCBI85 specimens
Genome at a glanceCCDB · GIFT · GoaT1.7 Gbp
01Narrative
Senecio vulgaris, often known by the common names groundsel and old-man-in-the-spring, is a flowering plant in the family Asteraceae. It is an annual herb, native to Europe and widely naturalised as a ruderal species in suitable disturbed habitats worldwide.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology26
Fruit length2 mm
Fruit length max2.5 mm
Fruit length min1.5 mm
Fruit width2 mm
Leaf length60 mm
Leaf length max100 mm
Leaf length min20 mm
Leaf mass17.59 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 513 mm² · GIFT: 513 mm²
Leaf width17.5 mm
⚠ sources differ — AusTraits: 17.5 mm · GIFT: 20 mm
Leaf width max45 mm
Leaf width min5 mm
Petiole length1 cm
Plant height0.32 m
⚠ sources differ — GIFT: 0.32 m · AusTraits: 0.4 m · LEDA: 0.2 m · USDA: 0.457 m · TRY: 0.5 m
Plant height generative0.188 m
Plant height max0.5 m
Plant height min0.05 m
Seed length1.99 mm
⚠ sources differ — TRY: 1.99 mm · GIFT: 1.8 mm
Seed length max1.8 mm
Seed length min1.8 mm
Seed mass0.213 mg
⚠ sources differ — TRY: 0.213 mg · LEDA: 0.269 mg · GIFT: 0.46 mg
Seed mass max0.33 mg
Seed mass min0.16 mg
Seed volume0.23 mm³
Seed volume max0.23 mm³
Seed volume min0.23 mm³
Life cycle & reproduction42
After harvest regrowth rateSlow
Bloom periodEarly Spring
Coppice potentialNo
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousNo
Flower length max10 mm
Flower length min8 mm
Flower width max4.5 mm
Flower width min4 mm
Flowering endApr
Flowering startDec
Flowering timennnnnyyyyyyn
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityfire_killed
Seed number2 714
Seed spread rateRapid
Seedling vigorHigh
Self fertilizationpresent
Sex typegynomonoecious
⚠ sources differ — AusTraits: gynomonoecious · GIFT: bisexual
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment34
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation mean1 300 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Growth form USDASingle Crown
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf formelliptic
Leaf retentionNo
Leaf shapeoblanceolate obovate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min120 days
Leaf C:N ratio17.48 g/g
Leaf c452 mg/g
Leaf dry-matter content (LDMC)116 mg/g
⚠ sources differ — TRY: 116 mg/g · LEDA: 84 mg/g
Leaf n37.73 mg/g
Leaf p1.9 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min16 in
Salinity toleranceNone
Seed longevity index0.5
Shade toleranceHigh
Soil pH max8.5 pH
Soil pH min5 pH
Specific leaf area (SLA)31.32 mm²/mg
Temperature min47 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound400 000 per lb
ToxicitySlight
Veneer productNo
Other traits7
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencepanicle
Seeds per fruit>1000
03Chemical composition59 compounds
Compounds documented for Senecio vulgaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Pyrrolizidine alkaloids23
Naphthoquinones3
Eudesmane sesquiterpenoids2
Polyamines2
Apocarotenoids (β-)2
Documented compounds59 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (15alpha,20R)-12,15,20-Trihydroxy-15,20-dihydrosenecionan-11,16-dione | present | LOTUS | |
| (1R,3aS,8aS)-7-(hydroxymethyl)-3a-methyl-1-propan-2-yl-1,2,3,5,6,8a-hexahydroazulen-4-one | present | LOTUS | |
| (1R,4Z,6R,7S,17R)-4-Ethylidene-7-hydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| (1R,4Z,7R,17S)-4-ethylidene-7-hydroxy-7-methyl-6-methylidene-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| (1R,6R,7S,17S)-4-ethylidene-7-hydroxy-7-(hydroxymethyl)-6-methyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| (1S,3aR,4R,7aS)-1-[(1S)-1-hydroxy-2-methylpropyl]-3a-methyl-7-methylidene-2,3,4,5,6,7a-hexahydro-1H-inden-4-ol | present | LOTUS | |
| (1S,4E,6S,7R,17S)-4-ethylidene-7-hydroxy-7-(hydroxymethyl)-6-methyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| (2S)-2-(dimethylazaniumyl)-3-(1-methyl-4-sulfanyl-1H-imidazol-5-yl)propanoate | present | NPASS | |
| (2S)-2-azaniumyl-3-(1-methyl-4-sulfanyl-1H-imidazol-5-yl)propanoate | present | NPASS | |
| (3S,5R,6S,7E)-5,6-Epoxy-3-hydroxy-7-megastigmen-9-one | present | LOTUS |
05DNA & barcoding85 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio vulgaris has left across the world's sequence archives.
At a glance
DNA specimens85
Marker genes9
GenBank sequences10
eDNA detections44
Countries10
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATC …
Senecio vulgaris voucher EDNA21-0060651 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK4★rbcL5★rbcLa★trnL-F★ITS1★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Senecio vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 672 380 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Senecio vulgaris1.67 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidy4× tetraploid · measured
Chromosome records20–402n range40median40mode93records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4084×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +17
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Králik E. & Hrozienčik I., 2000: Karyologické štúdium slovenskej flóry XXXIV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 43-46.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · iapt
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — Ingram, R., Noltie, H.J. Genetica 78: 21-24 (1989)
CCDB · brit-fl — Ingram, R., Noltie, H.J. Genetica 72: 37-41 (1987)
CCDB · brit-fl — Gibbs, P.E., Milne, C., Vargas Carillo, M. New Phytol. 75: 619-626 (1975)
CCDB · brit-fl — Crisp, P.C. (1972)
CCDB · brit-fl — Jones, K. (1969)
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · iber-fl — Sur la caryologie de quelques plantes rcoltes pendant la III Reunion de Botanique Pninsulaire. Fernandes, A. & M. Queirs.Mem. Soc. Brot.21: 343-385(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4089
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — D'Ovidio, R. 1984. Numeri cromosomici per la flora Italiana: 1011--1021. Inform. Bot. Ital. 16: 251–260.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Ingram, R. & H. J. Noltie. 1987. The control of chiasma frequency within a polyploid series in the genus Senecio (Compositae). Genetica 72: 37–41.
CCDB · ipcn-api-dl — Comes, H. & J. W. Kadereit. 1990. Aspects of hybridization between the closely related Senecio vulgaris L. and Senecio vernalis Waldst. & Kit. Flora 184: 381–388.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Slavĭk, B., V. Jarolĭmovă & J. Chrtek. 1993. Chromosome counts of some plants from Cyprus. Candollea 48(1): 221–230.
CCDB · ipcn-api-dl — Vogt, R. & A. Aparicio. 1999. Chromosome numbers of plants collected during Iter Mediterraneum IV in Cyprus. Bocconea 11: 117–169.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Alexander, J. C. M. 1979. The mediterranean species of Senecio sections Senecio and Delphinifolius. Notes Roy. Bot. Gard. Edinburgh 37: 387–428.
CCDB · ipcn-api-dl — Ingram, R., J. Weir & R. J. Abbott. 1980. New evidence concerning the origin of inland radiate groundsel, Senecio vulgaris var. hibernicus Syme. New Phytol. 84: 543–546.
CCDB · ipcn-api-dl — Keil, D. J. 1981. In Chromosome number reports LXXII. Taxon 30: 705–706.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Skalinska, M., E. Pogan, R. CZAPIK & e. al. 1978. Further studies in chromosome numbers of Polish angiosperms. XII. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Gibbs, P. E., C. MILNE & M. V. CARILLO. 1975. Correlation between the breeding system and recombination index in five species of Senecio. New Phytol. 75: 619–626.
CCDB · ipcn-api-dl — Harriman, N. A. 1978. In IOPB chromosome number reports LX. Taxon 27: 223–231.
CCDB · ipcn-api-dl — Arda, S. & G. OLGUN. 1994. Edirne çevresi Senecia L. türlerinin morfolojik, anatomik ve karyolojik olarak incelenmesi. XII. Ulusal Biyoloji Kongresi (6--8 Temmuz 1994, Edirne) II: 99--106.
CCDB · ipcn-api-dl — Kadereit, J. W. 1985. Chromosome Number Reports LXXXVI. Taxon 34: 159–164.
CCDB · book-ipcn72 — KLIPHUIS, E . & J.H. WIEFFERING. 1972. Chromosome numbers of some Angiosperms from the South of France. Acta Bot. Neer!. 21: 598-604.
+42 more references
2n 385×CCDB · ipcn-api-dl · CCDB · CromoCat 2015 · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of vascular plants from nature reserves of the Primorsky Territory and the Amur River basin. Bot. Žhurn. (Moscow & Leningrad) 91(7): 1117–1134.
CCDB · CromoCat 2015 — Probatova. (2006). Chromosome numbers of vascular plants from nature reserves of the Primorsky Territory and the Amur River basin. Bot. Žhurn. 91(7): 1117–1134.
CCDB · CromoCat 2015 — Gilmer, K. & Kadereit, J. W. (1989). The biology and affinities of Senecio teneriffae Schultz Bip., an annual endemic from the Canary Islands Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 111: 263-273
GIFT · GIFT (floras)
2n 204×CCDB · iber-fl · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015 +1
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I
CCDB · CromoCat 2015 — Queirós, M. (1973b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. II. Compositae, supl. 1. Bol. Soc. Brot. 47: 299-314.
GIFT · GIFT (floras)
2n 372×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gilmer, K. & Kadereit, J. W. (1989). The biology and affinities of Senecio teneriffae Schultz Bip., an annual endemic from the Canary Islands Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 111: 263-273
2n 412×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gilmer, K. & Kadereit, J. W. (1989). The biology and affinities of Senecio teneriffae Schultz Bip., an annual endemic from the Canary Islands Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 111: 263-273
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Malik, R.A., Gupta, R. C & Kumari, S. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1790
n 2023×CCDB · iapt · CCDB · iber-fl · CCDB · book-ipcn65 +4
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 452-465. Ruz de Clavijo Jimnez, E.Anales Jard. Bot. Madrid45(1): 259-266(1988).
CCDB · book-ipcn65 — Palmblad 1965
CCDB · ipcn-api-dl — Ruíz de Clavijo Jiménez, E. 1988. Números cromosomáticos de plantas occidentales, 452--465. Anales Jard. Bot. Madrid 45: 259–266.
CCDB · ipcn-api-dl — Ward, D. E. 1983. In: IOPB chromosome number reports LXXX. Taxon 32: 510–511.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Ingram, R., J. Weir & R. J. Abbott. 1980. New evidence concerning the origin of inland radiate groundsel, Senecio vulgaris var. hibernicus Syme. New Phytol. 84: 543–546.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — POWELL, A.M., & R.M. KING. 1969. Chromosome numbers in the Compositae: Colombian species. Amer. J. Bot. 56: 116-121.
CCDB · book-ipcn67-71 — TURNER, B.L. 1970. Chromosome numbers in the Compositae. XII Australian species. Amer. J. Bot. 57: 382-389.
CCDB · Cave1963 — Ornduff et al. 1963
CCDB · CromoCat 2015 — Gibbs, P. E., Milne, C. & Vargas Carrillo, M. (1975). Correlation between the breeding system and recombination index in five species of Senecio. New Phytol. 75: 619-626.
CCDB · CromoCat 2015 — Keil, D. J. & Pinkava, D. J. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 705-706.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1942a). Chromosome numbers of Scandinavian plant species. Bot. Not. 1942: 19-59.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Ornduff, R., P. H. Raven, D. W. Kyhos & A. R. Kruckeberg. (1963). Chromosome numbers in Compositae. III. Senecioneae. Amer. J. Bot. 50: 131-139.
CCDB · CromoCat 2015 — Powell, A. M. & R. M. King. (1969b). Chromosome numbers in the Compositae: Colombian species. Amer. J. Bot. 56: 116-121.
CCDB · CromoCat 2015 — Ruíz de Clavijo Jiménez, E. (1988). Números cromosomáticos de plantas occidentales, 452-465. Anales Jard. Bot. Madrid 45(1): 259-266.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Turner, B. L. (1970). Chromosome numbers in the Compositae. XII. Australian species. Amer. J. Bot. 57: 382-389.
CCDB · CromoCat 2015 — Vaarama, A. (1943). Beobachtungen über die meiose bei einigen antropochoren. Hereditas 29: 191-193.
n 07×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Probatova. (2006). Chromosome numbers of vascular plants from nature reserves of the Primorsky Territory and the Amur River basin. Bot. Žhurn. 91(7): 1117–1134.
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Moritz, R. S., Lubogoschinsky, P. I. & Sergeyeva, A. S. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:892-894
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
CCDB · CromoCat 2015 — Gilmer, K. & Kadereit, J. W. (1989). The biology and affinities of Senecio teneriffae Schultz Bip., an annual endemic from the Canary Islands Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 111: 263-273
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~0 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type572 710 records
Wild obs. + sensor558 656
Museum / vouchered13 098
Cultivated / captive26
Other930
Origin
Native40 098
Introduced412
Range
Area of Occupancy AOO630 960 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy45% within 1 km
≤100 m 102 220≤1 km 112 168≤10 km 256 644>10 km 4 628
475 660 georeferenced · 82 996 without coordinates
Open the mapobservation + sensor558 656
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 901≤1 km 2 067≤10 km 3 062>10 km 347
6 377 georeferenced · 6 721 without coordinates
Open the institutions mapphysical evidence13 098
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 14
15 georeferenced · 11 without coordinates
Open the mapnot free-living26
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions258 of 441 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 434 |
| Berlin, DE | 778 |
| LDlocation not on record | 403 |
| BFLlocation not on record | 316 |
| Görlitz, DE | 252 |
| Moscow State Universitylocation not on record | 206 |
| South Kensington, GB | 198 |
| Olocation not on record | 187 |
| Uniwersytet Warszawskilocation not on record | 183 |
| San Diego, US | 173 |
| Oulu, FI | 166 |
| Salzburg, AT | 163 |
| TROMlocation not on record | 160 |
| Uppsala, SE | 160 |
| Claremont, US | 160 |
| Odawara, JP | 142 |
| Riverside, US | 136 |
| CICYTEXlocation not on record | 135 |
| Trondheim, NO | 134 |
| Karlsruhe, DE | 129 |
| Oskarshamn, SE | 127 |
| València, ES | 119 |
| Santa Barbara, US | 116 |
| Chongqing Museumlocation not on record | 112 |
| Québec, CA | 107 |
| UChlocation not on record | 101 |
| Chiba, JP | 101 |
| SLU Artdatabankenlocation not on record | 96 |
| Bergen, NO | 95 |
| MAlocation not on record | 94 |
| Turku, FI | 91 |
| WTUlocation not on record | 90 |
| KMNlocation not on record | 85 |
| BDBClocation not on record | 82 |
| Jyväskylä, FI | 79 |
| Badajoz, ES | 76 |
| Bronx, US | 74 |
| Christchurch, NZ | 73 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 70 |
| Adam Mickiewicz University in Poznańlocation not on record | 70 |
| Garðabær, IS | 68 |
| Nagano City, JP | 66 |
| Adelaide, AU | 64 |
| Tartu, EE | 63 |
| Durango, MX | 62 |
| Shinshu Universitylocation not on record | 62 |
| Barcelona, ES | 61 |
| Tokushima, JP | 60 |
| NSMKlocation not on record | 59 |
| Córdoba, ES | 57 |
| Kuopio, FI | 57 |
| BClocation not on record | 56 |
| Saint Louis, US | 55 |
| TUR-Alocation not on record | 54 |
| Pullman, US | 53 |
| Davis, US | 52 |
| Provincia di Livornolocation not on record | 51 |
| Austin, US | 51 |
| Entomological Society of Latvialocation not on record | 48 |
| Montréal, CA | 48 |
| Madison, US | 47 |
| Wuzhou, CN | 47 |
| Chapel Hill, US | 44 |
| BRNUlocation not on record | 44 |
| Corvallis, US | 43 |
| University of Stellenboschlocation not on record | 42 |
| Beijing, CN | 42 |
| Auckland, NZ | 41 |
| Philadelphia, US | 41 |
| Mexico City, MX | 41 |
| San Luis Obispo, US | 40 |
| Salamanca, ES | 39 |
| Université Lavallocation not on record | 39 |
| Toronto, CA | 38 |
| Mexico City, MX | 38 |
| Vitoria, ES | 38 |
| CASlocation not on record | 36 |
| Museo Entomologico de Leonlocation not on record | 35 |
| Fukushima Universitylocation not on record | 34 |
| Acadia Universitylocation not on record | 33 |
| Fort Worth, US | 33 |
| Sanda, JP | 33 |
| UIBlocation not on record | 33 |
| Kochi, JP | 33 |
| ASUlocation not on record | 33 |
| Wlocation not on record | 32 |
| College of the Atlantic, Museumlocation not on record | 32 |
| UGentlocation not on record | 32 |
| University of Alberta Museumslocation not on record | 32 |
| Canadian Department of Agriculturelocation not on record | 31 |
| Ann Arbor, US | 31 |
| Hobart, AU | 31 |
| Madrid, ES | 31 |
| Bando, JP | 30 |
| Allentown, US | 30 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 29 |
| Tsukuba, JP | 28 |
| US | 28 |
| Kensington, AU | 27 |
| Tallinn, EE | 26 |
| Pamplona, ES | 26 |
| Moscow, US | 26 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 26 |
| Bern, CH | 25 |
| Toyama, JP | 25 |
| Arcata, US | 25 |
| Angwin, US | 24 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 24 |
| Victoria, CA | 23 |
| Hiratsuka City Museumlocation not on record | 23 |
| Burlington, US | 23 |
| Denver, US | 22 |
| Canberra, AU | 22 |
| Helsinki, FI | 21 |
| Alicante, ES | 21 |
| San Sebastián, ES | 20 |
| 20 | |
| KURAlocation not on record | 20 |
| Williamsburg, US | 19 |
| University of New Hampshirelocation not on record | 19 |
| Vancouver, CA | 19 |
| Irvine, US | 19 |
| Saint John, CA | 19 |
| Frankfurt am Main | 19 |
| Mount Annan, AU | 19 |
| New Haven, US | 18 |
| Turlock, US | 18 |
| Granada, ES | 18 |
| Ciudad Autónoma de Buenos Aires, AR | 18 |
| Porvoo, FI | 18 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 18 |
| Mlocation not on record | 18 |
| Wellington, NZ | 17 |
| Portland, US | 17 |
| Nagatoro-machi, Chichibu-gun, JP | 17 |
| Tomioka, JP | 17 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 17 |
| Kew, GB | 16 |
| Severin-McDaniel Insect Collectionlocation not on record | 16 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| Kushiro City Museumlocation not on record | 16 |
| Ishikawa Museum of Natural Historylocation not on record | 15 |
| Boise, US | 15 |
| Kunming, CN | 15 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| College Park, US | 15 |
| Chengdu, CN | 15 |
| Phyletisches Museum Jenalocation not on record | 15 |
| Bangkok, TH | 15 |
| New Brunswick, US | 14 |
| Valdosta State Universitylocation not on record | 13 |
| National Institute of Biological Resourceslocation not on record | 13 |
| Bozeman, US | 13 |
| MeiseBGlocation not on record | 13 |
| Brisbane, AU | 13 |
| Columbia, US | 12 |
| Otaru, JP | 12 |
| GJOlocation not on record | 12 |
| St. Paul, US | 12 |
| Sevilla, ES | 12 |
| Millersville, US | 11 |
| Green Bay, US | 11 |
| Porrentruy, CH | 11 |
| Dekalb, US | 10 |
| Phoenix, US | 10 |
| Stockholm, SE | 10 |
| Missoula, US | 10 |
| Sendai, JP | 10 |
| Bloomington, US | 10 |
| Iwate Prefectural Museumlocation not on record | 10 |
| San Francisco, US | 10 |
| Los Angeles, US | 10 |
| Flagstaff, US | 10 |
| CJBGlocation not on record | 10 |
| Zürich, CH | 10 |
| Dresden, DE | 10 |
| BAYLUlocation not on record | 9 |
| Yunnan Universitylocation not on record | 9 |
| Rotorua, NZ | 9 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 9 |
| KOMlocation not on record | 8 |
| Pamplona, ES | 8 |
| Montecillo, Texcoco, MX | 8 |
| Logan, US | 8 |
| Paris, FR | 8 |
| Torreón, MX | 8 |
| Universidad Nacional de Colombia (UNAL)location not on record | 8 |
| Coimbra, PT | 8 |
| Jaén, ES | 8 |
| Sagamihara, JP | 8 |
| Institute of the biological problems of the North FEB RASlocation not on record | 8 |
| Chadron, US | 8 |
| Akita Prefectural Museumlocation not on record | 8 |
| Zapopan, MX | 8 |
| Staten Island, US | 7 |
| IDElocation not on record | 7 |
| Beijing Normal Universitylocation not on record | 7 |
| KIRMlocation not on record | 7 |
| PrivatHerblocation not on record | 7 |
| Osaka, JP | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| PRClocation not on record | 7 |
| Dover, US | 7 |
| Xiamen, CN | 7 |
| Valparaiso, CL | 7 |
| Northridge, US | 7 |
| Taipei, TW | 7 |
| Jena Microbial Resource Collectionlocation not on record | 7 |
| KR | 7 |
| Uniwersytet Opolskilocation not on record | 6 |
| Tampa, US | 6 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 6 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 6 |
| Western Carolina Universitylocation not on record | 6 |
| Santa Cruz, US | 6 |
| JP | 6 |
| Long Beach, US | 6 |
| Kandalaksha State Nature Reservelocation not on record | 6 |
| San Isidro, AR | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Jackson, US | 6 |
| ifplocation not on record | 6 |
| Pocatello, US | 6 |
| Glarus, CH | 5 |
| Taipei, TW | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Catalina Island Conservancylocation not on record | 5 |
| Ashland, US | 5 |
| NMBU:MINAlocation not on record | 5 |
| Parthenon Tama History Museumlocation not on record | 5 |
| WNNUlocation not on record | 5 |
| Philadelphia, US | 5 |
| Albuquerque, US | 5 |
| Little Rock, US | 5 |
| Forssa, FI | 5 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Norfolk, US | 5 |
| DASSHlocation not on record | 5 |
| EL PASO, US | 5 |
| UoB-IBlocation not on record | 5 |
| Universidad de Nariño (UdeNar)location not on record | 5 |
| Altos de Pipe, VE | 5 |
| Provo, US | 4 |
| Guiyang, CN | 4 |
| Wuhan, CN | 4 |
| Lincoln, US | 4 |
| AUAlocation not on record | 4 |
| Anchorage, US | 4 |
| Bourges, FR | 4 |
| Memorial University of Newfoundlandlocation not on record | 4 |
| DMZ botanic gardenlocation not on record | 4 |
| Tilburg, NL | 4 |
| SZUlocation not on record | 4 |
| Nishihara, JP | 4 |
| Philadelphia, US | 4 |
| TAIElocation not on record | 4 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| Nishihara, JP | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Parkville, AU | 4 |
| Clemson, US | 3 |
| Puebla, MX | 3 |
| Cheney, US | 3 |
| Podgorica, ME | 3 |
| Palmerston North, NZ | 3 |
| SIHUlocation not on record | 3 |
| Fulda, DE | 3 |
| BSBIlocation not on record | 3 |
| Grand Junction, US | 3 |
| Cambridge, US | 3 |
| Fairfax, US | 3 |
| US | 3 |
| Guangzhou, CN | 3 |
| Stephenville, US | 3 |
| Frauenfeld, CH | 3 |
| Pretoria, ZA | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Obihiro Centennial City Museumlocation not on record | 3 |
| GAlocation not on record | 3 |
| San Angelo, US | 3 |
| Tuscaloosa, US | 3 |
| Rovaniemi, FI | 3 |
| Davenport, US | 3 |
| University of Southern Mississippilocation not on record | 2 |
| Palmerston, AU | 2 |
| LINUlocation not on record | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| Mississippi State, US | 2 |
| WINlocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| University of Lynchburglocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| Córdoba, AR | 2 |
| Rishon Le Zion, IL | 2 |
| Henderson, US | 2 |
| Aarhus, DK | 2 |
| Cochabamba, BO | 2 |
| Chicago, US | 2 |
| Whitehorse, CA | 2 |
| EEZA-CSIClocation not on record | 2 |
| Korea National Arboretumlocation not on record | 2 |
| Chengdu, CN | 2 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| Fredericksburg, US | 2 |
| Nijmegen, NL | 2 |
| Hudson, US | 2 |
| Yellowstone National Park Herbariumlocation not on record | 2 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 2 |
| Armidale, AU | 2 |
| Tromso University Museumlocation not on record | 2 |
| Wuhan, CN | 2 |
| Fayetteville, US | 2 |
| Portland, US | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| La Paz, BO | 2 |
| Asheville, US | 2 |
| Zacatecas, MX | 2 |
| Bend, US | 2 |
| Göteborg, SE | 2 |
| QVMAGlocation not on record | 2 |
| National Biodiversity Institute, Costa Ricalocation not on record | 2 |
| Knoxville, US | 2 |
| KNAMlocation not on record | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Emporia, US | 2 |
| KIWElocation not on record | 2 |
| Ensenada, MX | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Winterthur, CH | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Buenos Aires, AR | 2 |
| Taipei, TW | 2 |
| Oiso Municipal Museumlocation not on record | 1 |
| Minia, EG | 1 |
| IPA/SPlocation not on record | 1 |
| Xian, CN | 1 |
| INFlocation not on record | 1 |
| Valparaíso, CL | 1 |
| Mérida, MX | 1 |
| Chicago, US | 1 |
| H-Adlerlocation not on record | 1 |
| ROM007location not on record | 1 |
| Kagoshima, JP | 1 |
| Ypsilanti, US | 1 |
| IWEP FEB RASlocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| STNFlocation not on record | 1 |
| Yukon Universitylocation not on record | 1 |
| JBSlocation not on record | 1 |
| Banyoles, ES | 1 |
| Seoul, KR | 1 |
| Whitewater, US | 1 |
| Guasave, MX | 1 |
| Tacoma, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| München, DE | 1 |
| Edinburgh, GB | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| Johnson City, US | 1 |
| H-Dunkellocation not on record | 1 |
| Caldwell, US | 1 |
| San Jose, US | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Zürich, CH | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Harrisonburg, US | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Awka, NG | 1 |
| H-Schuhwlocation not on record | 1 |
| Washington, US | 1 |
| Guilin, CN | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Viña del Mar, CL | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| nbflocation not on record | 1 |
| BIO-UNIPIlocation not on record | 1 |
| HJAEFlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Arequipa, PE | 1 |
| Sapporo, JP | 1 |
| OLAlocation not on record | 1 |
| Dhaka, BD | 1 |
| Honolulu, US | 1 |
| Namur, BE | 1 |
| ESP109location not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| University of Patraslocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| FLADlocation not on record | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Morgantown, US | 1 |
| Mexico City, MX | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Hermosillo, MX | 1 |
| AASlocation not on record | 1 |
| JMSlocation not on record | 1 |
| Cape Town, ZA | 1 |
| MEXUlocation not on record | 1 |
| Durham, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Sion, CH | 1 |
| Denton, US | 1 |
| QCNElocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Monastir, TN | 1 |
| Austin, US | 1 |
| San José, CR | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| The Cattle Museumlocation not on record | 1 |
| Smithsonian Institutionlocation not on record | 1 |
| GB | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Anchorage, US | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Firenze, IT | 1 |
| Mie Prefectural Museumlocation not on record | 1 |
| Salvador, BR | 1 |
| Lubbock, US | 1 |
| ISAlocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| La Paz, MX | 1 |
| ENTClocation not on record | 1 |
| Brussel, BE | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
441 institutions · 12 075 of 13 098 vouchered records shown · 795 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA44 detections
Where the DNA of Senecio vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found44
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 44 detections have coordinates
Open the map9 countries0
weeds in gravelRiparian vegetation with Salix spp., Bacchar…Wetland swale in drainage between two rocky …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.6 °C 5.70–17.2
Seasonal swing summer↔winter16.5 °C
Max temp (day)18.4 °C 9.20–20.9
Min temp (night)8.50 °C 1.40–13.4
Precipitation73.1 mm/mo 48.7–113
Air humidity60.6 % 56.1–63.2
Moisture balance-20.6 mm/mo -46.7–43.0
Vapour deficit612 Pa 357–795
Wind speed3.00 m/s 2.10–5.60
Cloud cover41.2 % 33.5–55.8
CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.