Senecio triangularis
Hook. · speciesAt a glance
Occurrence records7 443
Data sources13
Biological traits90
DNA specimens21
eDNA detections11
Sources13 archives
Databases and archives Senecio triangularis's data was compiled from.
WikipediaWikimedia Foundation4 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 443 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics21 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources90 traits
Chemical compositionLOTUS · NPASS36 compounds
Occurrence & distributionGBIF7 443 records
Environmental DNA1 datasets · 2 countries11 detections
DNA & barcodingBOLD · NCBI21 specimens
Genome at a glanceCCDB2n = 40
01Narrative
Senecio triangularis, known as arrowleaf ragwort, arrowleaf groundsel and arrowleaf butterweed, is a species of the genus Senecio and family Asteraceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology5
Leaf size2 016 mm²
Plant height1.2 m
⚠ sources differ — GIFT: 1.2 m · USDA: 1.22 m · TRY: 0.498 m
Seed mass0.737 mg
⚠ sources differ — TRY: 0.737 mg · GIFT: 0.792 mg
Seed mass max0.759 mg
Seed mass min0.596 mg
Life cycle & reproduction23
After harvest regrowth rateSlow
Bloom periodMid Summer
Coppice potentialNo
Flower colouryellow
Flower conspicuousYes
Fruit seed period beginFall
Fruit seed period endFall
Growth rate USDAModerate
Life spanperennial
Lifespan categoryLong
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Seed spread rateModerate
Seedling vigorMedium
Vegetative spread rateSlow
Habitat & environment23
Active growth periodSummer and Fall
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
BloatNone
Climatetemperate
Climberself-supporting
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb
Growth form USDARhizomatous
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.00000000334
Root depth min10 in
Shape and orientationErect
Small grainNo
Woodinessvariable
Physiology & chemistry20
Anaerobic toleranceHigh
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min145 days
Moisture useHigh
Nitrogen fixation levelNone
Precipitation max60 in
Precipitation min14 in
Protein potentialMedium
Salinity toleranceNone
Shade toleranceMedium
Soil pH max7.8 pH
Soil pH min6.2 pH
Specific leaf area (SLA)23.73 mm²/mg
Temperature min-33 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound500 000 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
03Chemical composition36 compounds
Compounds documented for Senecio triangularis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Pyrrolizidine alkaloids18
Isoflavones10
Benzoquinones7
Documented compounds36 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,4E,6S,7R,17S)-4-ethylidene-7-hydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| (1R,4Z,6R,7R,17S)-4-ethylidene-7-hydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| (1R,4Z,6S,7R,11S,12S,17S)-4-ethylidene-7,12-dihydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadecane-3,8-dione | present | LOTUS | |
| (1R,4Z,6S,7R,11S,17S)-4-ethylidene-7-hydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadecane-3,8-dione | present | LOTUS | |
| (1R,6R,7S,17S)-4-ethylidene-7-hydroxy-7-(hydroxymethyl)-6-methyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| (3Z,5R,6R,9aS,10S,14aR,14bR)-3-Ethylidenedodecahydro-6,10-dihydroxy-5,6-dimethyl(1,6)dioxacyclododecino(2,3,4-gh)pyrrolizine-2,7-dione | present | LOTUS | |
| 2-Hydroxy-3-icosyl-5-methoxycyclohexa-2,5-diene-1,4-dione | present | NPASS | |
| 2-Hydroxy-5-methoxy-3-nonadecylcyclohexa-2,5-diene-1,4-dione | present | NPASS | |
| 3-Docosyl-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione | present | NPASS | |
| 3-Henicosyl-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione | present | NPASS |
05DNA & barcoding21 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio triangularis has left across the world's sequence archives.
At a glance
DNA specimens21
Marker genes7
GenBank sequences10
eDNA detections11
Countries2
The DNA barcodea real sequence read deposited for this species
TGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCA …
Senecio triangularis isolate LLV78 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★trnL-F★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Senecio triangularis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidypolyploid inferred
Chromosome records40–402n range40median40mode3records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 403×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Chinnappa, C. C. & J. G. Chmielewski. 1987. Documented plant chromosome numbers 1987: 1. Miscellaneous counts from western North America. Sida 12: 409–417.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · book-ipcn67-71 — ORNDUFF, R., T. MOSQUIN, D. W. KYHOS, & P. H. RAVEN. 1967. Chromosome numbers in Compositae. VI. Senecioneae. II. Am. Jour. Bot. 54: 205-213.
n 204×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · book-ipcn65 — Palmblad 1965
CCDB · ipcn-api-dl — Hartman, R. L. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · book-ipcn67-71 — ORNDUFF, R., T. MOSQUIN, D. W. KYHOS, & P. H. RAVEN. 1967. Chromosome numbers in Compositae. VI. Senecioneae. II. Am. Jour. Bot. 54: 205-213.
CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I
n 402×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Baker, M. A. & B. D. Parfitt. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 764–765.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 443 records
Wild obs. + sensor4 745
Museum / vouchered2 698
Origin
Native68
Range
Area of Occupancy AOO17 172 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 2 793≤1 km 444≤10 km 204>10 km 136
3 577 georeferenced · 1 168 without coordinates
Open the mapobservation + sensor4 745
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy56% within 1 km
≤100 m 158≤1 km 576≤10 km 536>10 km 44
1 314 georeferenced · 1 384 without coordinates
Open the institutions mapphysical evidence2 698
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions79 of 119 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| WTUlocation not on record | 229 |
| Moscow, US | 157 |
| Angwin, US | 155 |
| Pullman, US | 134 |
| Bronx, US | 120 |
| Victoria, CA | 113 |
| Arcata, US | 109 |
| University of Alberta Museumslocation not on record | 92 |
| Missoula, US | 86 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 83 |
| Claremont, US | 82 |
| Boise, US | 76 |
| Riverside, US | 73 |
| Vancouver, CA | 72 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 54 |
| Davis, US | 52 |
| Provo, US | 47 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 43 |
| Denver, US | 43 |
| Wuzhou, CN | 42 |
| Bozeman, US | 37 |
| CASlocation not on record | 36 |
| Albuquerque, US | 29 |
| Saint Louis, US | 27 |
| Durango, US | 27 |
| Santa Barbara, US | 26 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 25 |
| University of Lethbridgelocation not on record | 25 |
| Pocatello, US | 19 |
| Logan, US | 19 |
| DOI/NPS, Greenbelt Parklocation not on record | 18 |
| San Luis Obispo, US | 17 |
| Chongqing Museumlocation not on record | 17 |
| University of Stellenboschlocation not on record | 15 |
| Caldwell, US | 15 |
| San Diego, US | 14 |
| Canadian Department of Agriculturelocation not on record | 13 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 13 |
| Olocation not on record | 12 |
| Ashland, US | 12 |
| Corvallis, US | 12 |
| Whitehorse, CA | 11 |
| Pittsburg, US | 11 |
| Anchorage, US | 11 |
| Rocky Mountain Biological Laboratorylocation not on record | 11 |
| Flagstaff, US | 10 |
| Chadron, US | 9 |
| San Francisco, US | 7 |
| US | 7 |
| Cheney, US | 7 |
| Grand Junction, US | 7 |
| KNFYlocation not on record | 7 |
| Northridge, US | 6 |
| St. Paul, US | 6 |
| Stockholm, SE | 6 |
| Bend, US | 5 |
| Long Beach, US | 5 |
| Bloomington, US | 5 |
| Phoenix, US | 5 |
| Portland, US | 4 |
| Bangkok, TH | 4 |
| Orem, US | 4 |
| INFlocation not on record | 4 |
| Henderson, US | 4 |
| Mississippi State, US | 4 |
| Research Collection of B. A. Bennettlocation not on record | 4 |
| Moscow State Universitylocation not on record | 3 |
| Tacoma, US | 3 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 3 |
| KNFHClocation not on record | 3 |
| Québec, CA | 3 |
| Yukon Universitylocation not on record | 3 |
| Dekalb, US | 3 |
| Kew, GB | 3 |
| Montréal, CA | 2 |
| Yellowstone National Park Herbariumlocation not on record | 2 |
| Mlocation not on record | 2 |
| GB | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Columbia, US | 2 |
| STNFlocation not on record | 2 |
| Emporia, US | 2 |
| Université Lavallocation not on record | 2 |
| Beijing, CN | 1 |
| Knoxville, US | 1 |
| Fort Bragg, US | 1 |
| Auckland, NZ | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Spearfish, US | 1 |
| Johnson City, US | 1 |
| New Brunswick, US | 1 |
| AUAlocation not on record | 1 |
| US | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| Durham, US | 1 |
| Los Angeles, US | 1 |
| Chapel Hill, US | 1 |
| Truckee, US | 1 |
| Uppsala, SE | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Chicago, US | 1 |
| BAYLUlocation not on record | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| University of British Columbialocation not on record | 1 |
| Macomb, US | 1 |
| KNFSClocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Lincoln, US | 1 |
| ASUlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Saint John, CA | 1 |
| Irvine, US | 1 |
| Austin, US | 1 |
| Madison, US | 1 |
| EL PASO, US | 1 |
| Paris, FR | 1 |
| Calvin Collegelocation not on record | 1 |
119 institutions · 2 532 of 2 698 vouchered records shown · 165 without an institution code
09Environmental DNA11 detections
Where the DNA of Senecio triangularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map2 countries0
Stream corridor north of cabin ~20 m; Spruce…Burned in 2007. Huge seep that is on a slope…Open wet meadow.fir/willow/herb habitat on west-facing slope…moist areas on tundra with Oxyria digyna, Ju…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.7 °C 9.20–14.1
Seasonal swing summer↔winter26.2 °C
Max temp (day)17.3 °C 13.0–20.8
Min temp (night)6.00 °C 4.70–8.20
Precipitation79.7 mm/mo 42.0–149
Air humidity56.9 % 46.2–59.8
Moisture balance-27.7 mm/mo -84.8–41.8
Vapour deficit604 Pa 477–821
Wind speed3.30 m/s 2.00–5.80
Cloud cover37.8 % 26.2–47.5
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.