Senecio tamoides

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Senecio

At a glance

Occurrence records1 062

Data sources8

Biological traits31

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Senecio tamoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 062 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF1 062 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Senecio tamoides, also known as Canary creeper, is a climbing member of the genus Senecio of the family Asteraceae that is native to Southern Africa. It is used as an ornamental plant for its showy yellow, daisy-like flowers in autumn.Senecio tamoides (Canary creeper) by Plantinfo

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology12

Fruit length2 mm

Leaf length70 mm

Leaf length max50 mm

Leaf length min20 mm

Leaf width55 mm

Leaf width max70 mm

Leaf width min40 mm

Petiole length3.5 cm

Plant height2 m

Plant height max6 m

Plant height min0.69 m

Seed mass1.24 mg

Life cycle & reproduction5

Dehiscenceindehiscent

Flowering timennnnnyyynnnn

Life formscrambling shrub

Life spanperennial

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Elevation max1 905 m

Elevation min10 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: Climber

Habitat GIFTÁrea Antrópica

Leaf compoundnesssimple

Leaf shapeorbicular ovate

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio tamoides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON924665.1 ↗636 bpSouth Africa

ACGT

TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAACAATATATGGGTGTCCTTGGTATCAGGCGCTTGTCTGATTCTTTGGATGCCA …

Senecio tamoides isolate S_African_Coll_108_1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type1 062 records

Wild obs. + sensor771

Museum / vouchered237

Other54

Origin

Native1

Introduced30

Range

Area of Occupancy AOO2 296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 445≤1 km 107≤10 km 52>10 km 16

620 georeferenced · 151 without coordinates

Open the mapobservation + sensor771

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 8≤1 km 7≤10 km 11>10 km 6

32 georeferenced · 205 without coordinates

Open the institutions mapphysical evidence237

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	95
Durban, ZA	33
Cape Town, ZA	24
Brisbane, AU	17
Smithfield, AU	9
Mount Annan, AU	8
National Biodiversity Institute, Costa Ricalocation not on record	5
Canberra, AU	4
MAlocation not on record	3
University of Stellenboschlocation not on record	3
Kew, GB	3
MSB-3054location not on record	3
Berlin, DE	2
Stockholm, SE	2
John T. Waterhouse Herbariumlocation not on record	2
Bronx, US	2
South African National Biodiversity Institutelocation not on record	2
Plocation not on record	1
Guatemala City, GT	1
Barcelona, ES	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Museo Entomologico de Leonlocation not on record	1
University of Johannesburglocation not on record	1
Philadelphia, US	1
Instituto de Investigação Científica Tropicallocation not on record	1
Uppsala, SE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Saint Louis, US	1
Santa Teresa, BR	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Córdoba, AR	1
Alicante, ES	1
INMAlocation not on record	1
Batemans Bay, AU	1
BDBClocation not on record	1

35 institutions · 235 of 237 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Senecio tamoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 16.4–16.4

Seasonal swing summer↔winter10.7 °C

Max temp (day)22.5 °C

Min temp (night)10.3 °C

Precipitation58.9 mm/mo

Air humidity53.7 %

Moisture balance-52.2 mm/mo

Vapour deficit874 Pa

Wind speed1.60 m/s

Cloud cover19.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Senecio tamoides

At a glance

Sources8 archives

Size & morphology12

Life cycle & reproduction5

Diet & foraging1

Habitat & environment13

At a glance

Record type1 062 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 062 records