Senecio sylvaticus
speciesAt a glance
Occurrence records123 767
Data sources13
Biological traits54
DNA specimens23
eDNA detections13
Sources13 archives
Databases and archives Senecio sylvaticus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility123 767 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics23 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources54 traits
Chemical compositionLOTUS6 compounds
Occurrence & distributionGBIF123 767 records
Environmental DNA1 datasets · 5 countries13 detections
DNA & barcodingBOLD · NCBI23 specimens
Genome at a glanceCCDB · GIFT · GoaT2.1 Gbp
01Narrative
Le Séneçon des bois est une espèce de plante à fleurs de la vaste famille des Asteraceae (Composées). Ce sont des plantes herbacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology19
Fruit length2 mm
Fruit length max2.5 mm
Leaf length max150 mm
Leaf length min20 mm
Leaf mass181 mg
Leaf size5 336 mm²
Leaf width30 mm
Leaf width max30 mm
Leaf width min4 mm
Plant height0.388 m
⚠ sources differ — GIFT: 0.388 m · LEDA: 0.375 m · TRY: 0.562 m
Plant height generative0.494 m
Plant height max1.2 m
Plant height min0.05 m
Seed length4.15 mm
⚠ sources differ — TRY: 4.15 mm · GIFT: 2.3 mm
Seed length max2.3 mm
Seed length min2.3 mm
Seed mass0.252 mg
⚠ sources differ — TRY: 0.252 mg · LEDA: 0.232 mg · GIFT: 0.249 mg
Seed mass max0.345 mg
Seed mass min0.22 mg
Life cycle & reproduction15
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: dysochor · GIFT: anemochorous
Flowering endAug
Flowering startJun
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number10 638
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 200 m
Elevation min600 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTburn clearings, cut-over forest, forest, forest edges, meadows
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)114 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)29.49 mm²/mg
Other traits2
Diaspore typegenerative dispersule
Seeds per fruit>1000
03Chemical composition6 compounds
Compounds documented for Senecio sylvaticus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Pyrrolizidine alkaloids2
Eremophilane sesquiterpenoids2
Acetate-derived alkaloids $ Polyamines1
Polyamines1
Documented compounds6 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| [(1R,2R,4aS,5R,7R,8aR)-5-hydroxy-1,8a-dimethyl-6-oxo-7-prop-1-en-2-yl-1,2,3,4,4a,5,7,8-octahydronaphthalen-2-yl] (E)-2-methylbut-2-enoate | present | LOTUS | |
| [(1R,2R,4aS,5R,7R,8aR)-5-hydroxy-1,8a-dimethyl-6-oxo-7-prop-1-en-2-yl-1,2,3,4,4a,5,7,8-octahydronaphthalen-2-yl] 3-methylbut-2-enoate | present | LOTUS | |
| Putresine | present | LOTUS | |
| Sarracine | present | LOTUS | |
| Sperminidine | present | LOTUS | |
| Triangularine | present | LOTUS |
05DNA & barcoding23 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio sylvaticus has left across the world's sequence archives.
At a glance
DNA specimens23
Marker genes6
GenBank sequences10
eDNA detections13
Countries6
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATC …
Senecio sylvaticus voucher CCDB-18323-G11 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL5★rbcLa★ITS2★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Senecio sylvaticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 132 040 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Senecio sylvaticus2.13 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidy4× tetraploid · measured
Chromosome records40–402n range40median40mode36records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4036×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — BRULLO S., GUGLIELMO A., PAVONE P., TERRASI M.C. - 1992 (1991). Numeri cromosomici per la flora italiana: 1251-1266.. Inform. Bot. Ital. , 23(1): 39-47.
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Crisp, P.C. (1972)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4091
CCDB · fl-europaea — Femandes & Queiros,
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Brullo, S., A. Guglielmo, P. Pavone & M. C. Terrasi. 1991. Numeri cromosomici per la flora Italiana: 1251--1266. Inform. Bot. Ital. 23: 39–46.
CCDB · ipcn-api-dl — Vitek, E., M. Kiehn, K. Pascher, F. Starlinger, J. Greimler, U. Stocker, S. Lehner, P. Beinhofer & A. Blaha. 1992. Beiträge zur Flora von Österreich---weitere Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 129: 215–226.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Van Den Brand, C., F. C. M. V. Meel & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 395–397.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Vachova, M. 1976. In Index of chromosome uumbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Vachova, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Afzelius, K. (1924). Embryologische und zytologische studien in Senecio und ver wandten gattungen. Acta Horti Berg. 8: 123-219.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Den Brand, C., van, van Meel, F. C. M. & Wieffering, J. H. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 395-397.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.
CCDB · CromoCat 2015 — Hindakova, M. (1976). Index of chromosome numbers of Slovakian flora. (Part 5). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1-18.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Morton, J. K. (1977). A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211-223.
CCDB · CromoCat 2015 — Queirós, M. (1973b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. II. Compositae, supl. 1. Bol. Soc. Brot. 47: 299-314.
CCDB · CromoCat 2015 — Vitek, E., M. Kiehn, K. Pascher, F. Starlinger, J. Greimler, U. Stocker, S. Lehner, P. Beinhofer & A. Blaha (1992). Beiträge zur Flora von Österreich---weitere Chromosomenzählungen. Verhandlungen der Zoologisch-botanischen Gesellschaft in Wien 129: 215-22
GIFT · GIFT (floras)
n 2010×CCDB · iber-fl · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +2
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 290-294. Gallego, M. J.Lagascalia12(1): 131-132(1983).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 691-719. Diosdado, J. C. & al.Lagascalia17(1): 173-184(1993).
CCDB · book-ipcn65 — Palmblad 1965
CCDB · ipcn-api-dl — Gallego, M. J. 1983. Números 290-294, in Números cromosómicos para la flora española. 257-300. Lagascalia 12: 131–132.
CCDB · ipcn-api-dl — Diosdado, J. C., C. Santa-Bárbara, J. Vioque, R. Juan & J. Pastor. 1993. Números cromosomáticos para la flora Española. 691--719. Lagascalia 17: 173–184.
CCDB · Cave1963 — Orndu:ff et al. 1963
CCDB · CromoCat 2015 — Diosdado, J. C., Santa-Barbara, C. Vioque, J., Juan, R. & Pastor, J. (1993a). Números cromosómicos para la flora española. 691-719. Lagascalia 17(1): 173-184.
CCDB · CromoCat 2015 — Gallego, M. J. (1983). Números cromosómicos para la flora española, 290-294. Lagascalia 12(1): 131-132.
CCDB · CromoCat 2015 — Ornduff, R., P. H. Raven, D. W. Kyhos & A. R. Kruckeberg. (1963). Chromosome numbers in Compositae. III. Senecioneae. Amer. J. Bot. 50: 131-139.
CCDB · CromoCat 2015 — Santa Bárbara, C., J. Vioque, R. Juan, J. Pastor & J. C. Diosdado. (1994). Números cromosómicos para la flora española. 720-747. Lagascalia 17(2): 367-379.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.1% BUSCO
08Occurrence & distribution
Record type123 767 records
Wild obs. + sensor118 548
Museum / vouchered5 052
Cultivated / captive47
Other120
Origin
Native12 637
Introduced1
Range
Area of Occupancy AOO214 860 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy43% within 1 km
≤100 m 22 467≤1 km 20 521≤10 km 56 887>10 km 421
100 296 georeferenced · 18 252 without coordinates
Open the mapobservation + sensor118 548
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 445≤1 km 895≤10 km 1 263>10 km 270
2 873 georeferenced · 2 179 without coordinates
Open the institutions mapphysical evidence5 052
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 18
19 georeferenced · 28 without coordinates
Open the mapnot free-living47
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions109 of 188 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 638 |
| Olocation not on record | 344 |
| LDlocation not on record | 321 |
| BFLlocation not on record | 287 |
| Uppsala, SE | 231 |
| Turku, FI | 173 |
| Oulu, FI | 151 |
| Bergen, NO | 130 |
| KMNlocation not on record | 120 |
| Oskarshamn, SE | 94 |
| SLU Artdatabankenlocation not on record | 84 |
| Moscow State Universitylocation not on record | 79 |
| Tartu, EE | 78 |
| Salzburg, AT | 68 |
| Corvallis, US | 63 |
| Provincia di Livornolocation not on record | 59 |
| WTUlocation not on record | 52 |
| Görlitz, DE | 51 |
| South Kensington, GB | 46 |
| TUR-Alocation not on record | 46 |
| BIO-UNIPIlocation not on record | 44 |
| Auckland, NZ | 40 |
| ISAlocation not on record | 36 |
| MAlocation not on record | 36 |
| Christchurch, NZ | 35 |
| Zürich, CH | 35 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 32 |
| Badajoz, ES | 32 |
| CICYTEXlocation not on record | 31 |
| Vitoria, ES | 31 |
| DBF-NHMDlocation not on record | 29 |
| Pullman, US | 29 |
| Helsinki, FI | 27 |
| Entomological Society of Latvialocation not on record | 27 |
| Acadia Universitylocation not on record | 24 |
| Berlin, DE | 24 |
| Trondheim, NO | 24 |
| Zürich, CH | 23 |
| Saint John, CA | 23 |
| Salamanca, ES | 23 |
| Bern, CH | 23 |
| València, ES | 22 |
| Vancouver, CA | 20 |
| Tallinn, EE | 19 |
| Canadian Department of Agriculturelocation not on record | 17 |
| Karlsruhe, DE | 17 |
| Davis, US | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| Arcata, US | 17 |
| BRNUlocation not on record | 17 |
| Jyväskylä, FI | 15 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 15 |
| Wlocation not on record | 15 |
| San Sebastián, ES | 15 |
| Barcelona, ES | 14 |
| Madrid, ES | 13 |
| Kuopio, FI | 13 |
| GJOlocation not on record | 12 |
| University of New Hampshirelocation not on record | 12 |
| Claremont, US | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Wellington, NZ | 12 |
| BISHlocation not on record | 11 |
| Rotorua, NZ | 11 |
| Santa Cruz, US | 10 |
| Uniwersytet Warszawskilocation not on record | 10 |
| Angwin, US | 9 |
| Stockholm, SE | 9 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 9 |
| NMBU:MINAlocation not on record | 9 |
| University of Stellenboschlocation not on record | 9 |
| Porrentruy, CH | 8 |
| Frankfurt am Main | 8 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 7 |
| Chongqing Museumlocation not on record | 7 |
| Kew, GB | 7 |
| CASlocation not on record | 7 |
| BClocation not on record | 6 |
| TROMlocation not on record | 6 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 6 |
| Mlocation not on record | 6 |
| Boise, US | 6 |
| Dresden, DE | 6 |
| Philadelphia, US | 6 |
| Coimbra, PT | 6 |
| Porvoo, FI | 6 |
| Victoria, CA | 6 |
| Frauenfeld, CH | 5 |
| Moscow, US | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Tacoma, US | 5 |
| Bourges, FR | 5 |
| Granada, ES | 5 |
| San Luis Obispo, US | 4 |
| Portland, US | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Wuzhou, CN | 4 |
| Podgorica, ME | 4 |
| PRClocation not on record | 4 |
| Québec, CA | 4 |
| San Francisco, US | 4 |
| Minia, EG | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Columbia, US | 3 |
| Ashland, US | 3 |
| Tilburg, NL | 3 |
| Bloomington, US | 3 |
| Museo Achille Folettolocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Burlington, US | 3 |
| Dekalb, US | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Alicante, ES | 3 |
| Paris, FR | 3 |
| Ciudad Autónoma de Buenos Aires, AR | 3 |
| Bend, US | 3 |
| Montréal, CA | 3 |
| Namur, BE | 3 |
| Honolulu, US | 3 |
| MeiseBGlocation not on record | 2 |
| Saint Louis, US | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Göteborg, SE | 2 |
| Durham, US | 2 |
| GZUlocation not on record | 2 |
| Nijmegen, NL | 2 |
| Whitehorse, CA | 2 |
| Santa Barbara, US | 2 |
| H-Schuhwlocation not on record | 2 |
| Pamplona, ES | 2 |
| Umeå Universitylocation not on record | 2 |
| Los Angeles, US | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| Université Lavallocation not on record | 2 |
| National Museum Waleslocation not on record | 1 |
| AUAlocation not on record | 1 |
| Davenport, US | 1 |
| Moscow University Herbarium (MW)location not on record | 1 |
| Trois-Rivières, CA | 1 |
| H-AkrKGlocation not on record | 1 |
| H-Lippertlocation not on record | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| San Diego, US | 1 |
| Bronx, US | 1 |
| Mississippi State, US | 1 |
| Odawara, JP | 1 |
| H-Wolflocation not on record | 1 |
| Tuscaloosa, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Canberra, AU | 1 |
| Madison, US | 1 |
| HJAEFlocation not on record | 1 |
| Jaén, ES | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Fort Worth, US | 1 |
| San Jose, US | 1 |
| CJBNlocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Denver, US | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| KNFHClocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Lausanne, CH | 1 |
| Tromso University Museumlocation not on record | 1 |
| Valparaiso, CL | 1 |
| Banyoles, ES | 1 |
| Fulda, DE | 1 |
| Northridge, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Ann Arbor, US | 1 |
| Bangkok, TH | 1 |
| Xiamen, CN | 1 |
| Riverside, US | 1 |
| US | 1 |
| BDBClocation not on record | 1 |
| Forssa, FI | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Logan, US | 1 |
| Tempe, US | 1 |
| Sevilla, ES | 1 |
| FLADlocation not on record | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
188 institutions · 4 461 of 5 052 vouchered records shown · 515 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA13 detections
Where the DNA of Senecio sylvaticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map5 countries0
coastal cliff
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.2 °C 10.9–16.9
Seasonal swing summer↔winter13.6 °C
Max temp (day)15.5 °C 12.3–21.1
Min temp (night)12.1 °C 7.70–13.2
Precipitation75.8 mm/mo 49.7–122
Air humidity63.8 % 58.4–65.8
Moisture balance66.5 mm/mo
Vapour deficit609 Pa 467–796
Wind speed3.60 m/s
Cloud cover47.2 % 40.0–55.6
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.