Senecio ruwenzoriensis

S.Moore · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Senecio

At a glance

Occurrence records245

Data sources10

Biological traits14

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Senecio ruwenzoriensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility245 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources14 traits

Chemical compositionLOTUS · NPASS139 compounds

Occurrence & distributionGBIF245 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Кресто́вник малоли́стный, или Крестовник кирги́зский — многолетнее растение; вид рода Крестовник (Senecio), семейства Астровые (Asteraceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology2

Plant height max0.75 m

Plant height min0.15 m

Life cycle & reproduction3

Dispersal typewind

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max2 850 m

Elevation min85 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition139 compounds

Compounds documented for Senecio ruwenzoriensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids12

Labdane diterpenoids9

Eudesmane sesquiterpenoids6

Pyrrolizidine alkaloids6

Labdane diterpenoids $ Norlabdane diterpenoids5

Documented compounds139 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	NPASS
(1R,2E,5R,6E,10S)-3,7-dimethyl-10-propan-2-ylcyclodeca-2,6-diene-1,5-diol	present	NPASS
(1R,2R,3S,6E,8R,10S)-6,10-dimethyl-3-propan-2-yl-11-oxabicyclo[8.1.0]undec-6-ene-2,8-diol	present	NPASS
(1R,2R,4aR,8R,8aS)-2-(2-hydroxypropan-2-yl)-4a-methyl-2,3,4,5,6,7,8,8a-octahydro-1H-naphthalene-1,8-diol	present	NPASS
(1R,4As,8Ar)-5,5,8A-Trimethyl-4-Oxo-1-[(E)-2-(5-Oxo-2H-Furan-4-Yl)Ethenyl]-4A,6,7,8-Tetrahydro-1H-Naphthalene-2-Carbaldehyde	present	NPASS
(1R,4S,5E,7S)-4-methyl-10-methylidene-7-propan-2-ylcyclodec-5-ene-1,4-diol	present	NPASS
(1R,4S,6R,10S)-4,12,12-trimethyl-9-methylidene-5-oxatricyclo[8.2.0.04,6]dodecane	present	NPASS
(1R,4S,6R,7R,17R)-4-ethyl-4,7-dihydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione	present	LOTUS
(1R,4S,6R,7S,17R)-4-ethyl-4,7-dihydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione	present	LOTUS
(1S,2R,4aR,5R,8aR)-4a-methyl-8-methylidene-2-propan-2-yl-1,2,3,4,5,6,7,8a-octahydronaphthalene-1,5-diol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio ruwenzoriensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKX494504.1 ↗595 bp

ACGT

TCGAAACCTGCATAGCAGAACGACCCGTGAACTTGTAACAACAACACGTTGATGTGCCTCTTTGGTAAGCCCTTTGGGTCCTAAGGATGT …

Senecio ruwenzoriensis isolate 11.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Senecio ruwenzoriensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 201×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — AFZELIUS, K. 1967. Chromosome numbers in some Senecioneae. svensk Bot. Tidskr. 61: 1-9.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type245 records

Wild obs. + sensor51

Museum / vouchered194

Range

Area of Occupancy AOO752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 32≤1 km 6>10 km 5

43 georeferenced · 8 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence194

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	55
MeiseBGlocation not on record	34
Kew, GB	17
Yaoundé, CM	14
Saint Louis, US	13
Durban, ZA	8
Adam Mickiewicz University in Poznańlocation not on record	6
Cape Town, ZA	5
Paris, FR	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	3
TAFORI-LSRClocation not on record	3
Stockholm, SE	1
Plocation not on record	1
MAlocation not on record	1
DSMlocation not on record	1
University of Stellenboschlocation not on record	1
WAGlocation not on record	1
Arusha, TZ	1
Bloomington, US	1

19 institutions · 170 of 194 vouchered records shown · 24 without an institution code

09Environmental DNA1 detections

Where the DNA of Senecio ruwenzoriensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)