Senecio nevadensis

Boiss. & Reut. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Senecio

At a glance

Occurrence records56

Data sources9

Biological traits4

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Senecio nevadensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF56 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Senecio nevadensis adalah spesies tumbuhan yang tergolong ke dalam famili Asteraceae. Spesies ini juga merupakan bagian dari ordo Asterales. Spesies Senecio nevadensis sendiri merupakan bagian dari genus Senecio. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Boiss. & Reut..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass0.41 mg

Life cycle & reproduction1

Life formsubshrub

Habitat & environment2

Climatetemperate

Growth formsubshrub

03Chemical composition3 compounds

Compounds documented for Senecio nevadensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pyrrolizidine alkaloids3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,4E,6S,7R,17S)-4-ethylidene-7-hydroxy-7-(hydroxymethyl)-6-methyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione	present	LOTUS
Integerrimine	present	LOTUS
Usaramine	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio nevadensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU818664.1 ↗762 bpSpain

ACGT

GGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACCTGTGAACATGT …

Senecio nevadensis isolate 1095 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Senecio nevadensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · iber-fl · CCDB · ipcn-api-dl

CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 654-660 Blanca, G. & M. Cueto.Anales Jard. Bot. Madrid50: 83(1992).

CCDB · ipcn-api-dl — Talavera, S., M. Arista, P. L. Ortiz & F. Bastida. 1994. Notas cariolo|3gicas sobre algunas compuestas de Marruecos. Acta Bot. Malac. 19: 97–101.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type56 records

Wild obs. + sensor36

Museum / vouchered20

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 10≤1 km 3≤10 km 20>10 km 1

34 georeferenced · 2 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 4≤10 km 5

10 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Granada, ES	6
MAlocation not on record	3
Wlocation not on record	3
BClocation not on record	2
Dresden, DE	1
Barcelona, ES	1
College of the Atlantic, Museumlocation not on record	1
Entomological Society of Latvialocation not on record	1

8 institutions · 18 of 20 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Senecio nevadensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa 953–953

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)