Senecio nemorensis
speciesAt a glance
Occurrence records15 899
Data sources12
Biological traits36
DNA specimens16
eDNA detections10
Sources12 archives
Databases and archives Senecio nemorensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility15 899 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics16 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources36 traits
Chemical compositionLOTUS · NPASS89 compounds
Occurrence & distributionGBIF15 899 records
Environmental DNA1 datasets · 3 countries10 detections
DNA & barcodingBOLD · NCBI16 specimens
Genome at a glanceCCDB2n = 40
01Narrative
Il senecion silvano è una specie di pianta angiosperma dicotiledone della famiglia delle Asteraceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDAGIFTWCVP
Size & morphology11
Fruit length4.5 mm
Fruit length max5 mm
Fruit length min4 mm
Leaf length140 mm
Leaf length max180 mm
Leaf length min100 mm
Leaf size8 456 mm²
Leaf width max40 mm
Leaf width min25 mm
Plant height max1.5 m
Plant height min0.5 m
Life cycle & reproduction11
Dispersal typeanimal
⚠ sources differ — LEDA: dysochor · GIFT: anemochorous
Flowering endAug
Flowering startJul
Life formperennial or rhizomatous geophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Seed number48 946
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation mean1 885 m
Elevation min770 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, forest edges, meadows, mountains, rivers, shrubberies
Woodinessnon-woody
Physiology & chemistry3
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)36.89 mm²/mg
03Chemical composition89 compounds
Compounds documented for Senecio nemorensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Pyrrolizidine alkaloids17
Eremophilane sesquiterpenoids16
Flavones4
Eudesmane sesquiterpenoids3
Hydrocarbons3
Documented compounds89 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol | present | LOTUS | |
| (1R,3R,5R,6R,7S,9S,10R,13S)-3,5-dimethoxy-6,9,10-trimethyl-4,14-dioxatetracyclo[7.5.0.01,13.03,7]tetradecane-6,7-diol | present | LOTUS | |
| (1R,3S,6R,7S,9S,10R,13S)-7-hydroxy-3-methoxy-6,9,10-trimethyl-4,14-dioxatetracyclo[7.5.0.01,13.03,7]tetradecan-5-one | present | LOTUS | |
| (1R,4Z,7R,8R,12S,18R)-8-hydroxy-5,7,8-trimethyl-2,10-dioxa-15-azatricyclo[10.5.1.015,18]octadec-4-ene-3,9-dione | present | LOTUS | |
| (1R,4Z,7S,8S,12S,18R)-8-hydroxy-5,7,8-trimethyl-2,10-dioxa-15-azatricyclo[10.5.1.015,18]octadec-4-ene-3,9-dione | present | LOTUS | |
| (1R,5R,7R,8R,12S,18R)-5,7,8-trimethyl-2,10,19-trioxa-15-azatetracyclo[10.5.1.15,8.015,18]nonadecane-3,9-dione | present | LOTUS | |
| (1R,5S,7R,8R,12R,18R)-5,7,8-trimethyl-2,10,19-trioxa-15-azatetracyclo[10.5.1.15,8.015,18]nonadecane-3,9-dione | present | LOTUS | |
| (1R,5S,7R,8R,18R)-5,7,8-trimethyl-2,10,19-trioxa-15-azatetracyclo[10.5.1.15,8.015,18]nonadec-12-ene-3,9-dione | present | LOTUS | |
| (1R,5S,7S,8S,12S,18R)-5,7,8-trimethyl-2,10,19-trioxa-15-azatetracyclo[10.5.1.15,8.015,18]nonadecane-3,9-dione | present | LOTUS | |
| (1S,2S,4aR,5R,8R,8aS)-4a-methyl-2-propan-2-ylspiro[1,2,3,4,5,6,7,8a-octahydronaphthalene-8,2'-oxirane]-1,5-diol | present | LOTUS |
05DNA & barcoding16 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio nemorensis has left across the world's sequence archives.
At a glance
DNA specimens16
Marker genes5
GenBank sequences10
eDNA detections10
Countries3
The DNA barcodea real sequence read deposited for this species
TTGTCGAAACCTGCATAGCAGAACGACCTGTGAACATGTAACAACAATTGGGTGTTCTAAGTATCGGGCTCTTGTCCGATTCCTAGGATG …
Senecio nemorensis isolate J1090 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Senecio nemorensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidypolyploid inferred
Chromosome records20–482n range40median40mode43records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4039×CCDB · ita-fl · CCDB · slov-fl · CCDB · nw-europe-fl +10
CCDB · ita-fl — GIORDANI A., MICELI P., MONTI G. - 1980. Numeri cromosomici per la flora italiana:789-793.. Inform. Bot. Ital. , 12(3): 327-332.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Váchová M. & Feráková V., 1980: [Report], pp. 722-723. - In: Löve Á. (ed.), Chromosome numbers reports LXIX, Taxon 29 /5-6.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Hodálová I. & Kochjarová J., 2006: Chromosome numbers and pollen fertility in the Senecio nemorensis group (Compasitae) in the Carpathians. - Biologia (Bratislava) 61/1: 37-40.
CCDB · slov-fl — Lindauerová T. & Maláriková Z., 1972: Adatok a Senecio erucifolius L., S. nemorensis L., Erechthites hieraciifolia (L.) Raf., Ligularia clivorum Maxim. és Arnica montana L. citológiai viszonyaihoz. - Bot. Közlem. 59/1: 31-32.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4078
CCDB · fl-europaea — Majovsky e t a l . ,
CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.
CCDB · ipcn-api-dl — Pulkina, S. V. 1988. Chromosome numbers in some species of the Asteraceae. Bot. Žhurn. (Moscow & Leningrad) 73: 607–608.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1988. Chromosome numbers in some species of Asparagaceae, Asteraceae and Ranunculaceae from the north Urals (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 73: 605–607.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1983. Chromosome numbers of some species of the family Asteraceae II. Bot. Zhurn. SSSR 68(5): 660–664. (In Russian).
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1987. Chromosome numbers in some members of the Urals flora (the Komi Autonomous Soviet Socialist Republic). Bot. Zhurn. SSSR 72: 846–847.
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1989. Chromosome numbers in some species of flowering plants of the Urals (the Komi Autonomous Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 74: 1059–1061.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Javurkova, V. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 400–401.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1975. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 60(6): 864–872.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · ipcn-api-dl — Micelli, P. & G. Monti. 1980. Numeri cromosomici per la Flora Italiana: 787-793. Inform. Bot. Ital. 12: 327–332.
CCDB · ipcn-api-dl — Vachova, M. & V. Ferakova. 1980. In Chromosome number reports LXIX. Taxon 29: 722–723.
CCDB · ipcn-api-dl — Pogan, E., H. Wcislow & A. Jankun. 1980. Further studies in chromosome numbers of Polish Angiosperms Part XlIl. Acta Biol. Cracov., Ser. Bot. 22: 37–69.
CCDB · ipcn-api-dl — Herborg, J. 1987. Die Variabilität und Sippenabgrenzung in der Senecio nemorensis--Gruppe (Compositae) im europäischen Teilareal. Diss. Bot. 107: 1–262.
CCDB · book-ipcn72 — LINDAUEROVA, T., & T. MALARIKOVA. 1972. Angaben zur zytologischen Verhaltnisse von Senecio erucifolius, s. nemorensis, Erechthites hieraciifolia, Ligularia clivorum, und~Arnica rnontana. Bot. Kozlem. 59: 31-32.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — ARANO, H. 1968. The karyotypes and the geographical distribution in some groups of subfamily (Compositae) Of Japan. Kromosomo 72-73: 2371-2388.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-northern-plants — Matsuura & Suto 1935.
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.
CCDB · eflora
CCDB · book-atlas-flowering-plants — M. & S. 1935
CCDB · iapt — IAPT/IOPB Chromosome Data 26
2n 362×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Rostovtseva, T. S. & A. A. Nechayev. 1981. Chromosomhye chisla nekotorych vidov flory Sibiri. Sb. Novye Dannye o Fitogeografii Sibiri. 220–224.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.
2n 201×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Kuzmanova, B., S. Georgieva & V. Nikolova. 1979a. In IOPB chromosome number reports LXIV. Taxon 28:408.
2n 481×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Magulaev, A. Y. 1982. The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus. Biol. Nauki (Moscow) 11 (227): 74–79.
n 203×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1983. Chromosome numbers of some species of the family Asteraceae II. Bot. Zhurn. SSSR 68(5): 660–664. (In Russian).
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · book-ipcn67-71 — HSU, c.-c. 1970. Preliminary chromosome studies on the vascular plants of Taiwan (III) The aster family, Compositae. Taiwania 15: 17-29.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type15 899 records
Wild obs. + sensor6 693
Museum / vouchered9 187
Fossil4
Other15
Origin
Native13
Range
Area of Occupancy AOO24 248 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 1 860≤1 km 1 450≤10 km 1 451>10 km 511
5 272 georeferenced · 1 421 without coordinates
Open the mapobservation + sensor6 693
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy19% within 1 km
≤100 m 379≤1 km 1 049≤10 km 5 842>10 km 152
7 422 georeferenced · 1 765 without coordinates
Open the institutions mapphysical evidence9 187
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions65 of 138 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 6 370 |
| Salzburg, AT | 336 |
| Moscow State Universitylocation not on record | 307 |
| Beijing, CN | 222 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 169 |
| Shinshu Universitylocation not on record | 133 |
| Hokkaido University Museumlocation not on record | 87 |
| Nagano City, JP | 77 |
| Odawara, JP | 73 |
| Tomioka, JP | 59 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 47 |
| Yangling, CN | 45 |
| Urumqi, CN | 37 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 37 |
| Karlsruhe, DE | 32 |
| WNNUlocation not on record | 31 |
| Taipei, TW | 30 |
| JP | 29 |
| Taipei, TW | 28 |
| Toyama, JP | 25 |
| ifplocation not on record | 20 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 18 |
| Wuhan, CN | 17 |
| SIHUlocation not on record | 17 |
| BIO-UNIPIlocation not on record | 16 |
| Xining, CN | 16 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 16 |
| Taipei, TW | 14 |
| BRNUlocation not on record | 14 |
| Akita Prefectural Museumlocation not on record | 14 |
| TAIElocation not on record | 13 |
| KIRMlocation not on record | 12 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 12 |
| Nanjing, CN | 12 |
| Mlocation not on record | 10 |
| Sanda, JP | 10 |
| LDlocation not on record | 10 |
| Kunming, CN | 10 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 9 |
| Guangzhou, CN | 9 |
| KR | 9 |
| Ishikawa Museum of Natural Historylocation not on record | 9 |
| ENTClocation not on record | 8 |
| Nagasaki University - Fisherieslocation not on record | 8 |
| Kushiro City Museumlocation not on record | 8 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 8 |
| Chengdu, CN | 8 |
| Hangzhou, CN | 8 |
| 东北师范大学自然博物馆location not on record | 8 |
| Provincia di Livornolocation not on record | 8 |
| Porrentruy, CH | 8 |
| Wlocation not on record | 8 |
| WTUlocation not on record | 8 |
| Urumqi, CN | 8 |
| Central China Normal Universitylocation not on record | 7 |
| KOMlocation not on record | 7 |
| Uppsala, SE | 7 |
| Olocation not on record | 7 |
| Berlin, DE | 7 |
| Kyoto Universitylocation not on record | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| GJOlocation not on record | 6 |
| CASlocation not on record | 6 |
| Chiba, JP | 6 |
| MeiseBGlocation not on record | 5 |
| Peking Universitylocation not on record | 5 |
| Lanzhou, CN | 5 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 5 |
| Sendai, JP | 5 |
| Shanxi Institute of Biologylocation not on record | 5 |
| MAlocation not on record | 5 |
| BFLlocation not on record | 5 |
| IWEP FEB RASlocation not on record | 5 |
| Servico de Microbiologia e Imunologialocation not on record | 4 |
| Tallinn, EE | 4 |
| Guilin, CN | 4 |
| Tilburg, NL | 4 |
| Tianjin Natural History Museumlocation not on record | 4 |
| BClocation not on record | 4 |
| Northeastern Forestry Universitylocation not on record | 4 |
| SZUlocation not on record | 4 |
| Fukushima Universitylocation not on record | 4 |
| Herbarium of South China Botanical Gardenlocation not on record | 3 |
| Saint Louis, US | 3 |
| Görlitz, DE | 3 |
| Inner Mongolia Universitylocation not on record | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Dresden, DE | 3 |
| Xiamen, CN | 2 |
| Sagamihara, JP | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| Seoul, KR | 2 |
| Obihiro Centennial City Museumlocation not on record | 2 |
| Zhengzhou, CN | 2 |
| UGentlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Shanghai, CN | 2 |
| Nanjing, CN | 2 |
| València, ES | 2 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Fort Worth, US | 1 |
| Stockholm, SE | 1 |
| Kew, GB | 1 |
| BDBClocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Nanchong, CN | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Chengdu, CN | 1 |
| Burlington, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Xian, CN | 1 |
| Philadelphia, US | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Frankfurt am Main | 1 |
| Tsukuba, JP | 1 |
| PRClocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| EL PASO, US | 1 |
| Granada, ES | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Salamanca, ES | 1 |
| Paris, FR | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Guiyang, CN | 1 |
| Awka, NG | 1 |
| Guiyang, CN | 1 |
| Badajoz, ES | 1 |
| Zhuzhou, CN | 1 |
| Shanghai, CN | 1 |
| Trondheim, NO | 1 |
| Jishou Universitylocation not on record | 1 |
| Nijmegen, NL | 1 |
| Tartu, EE | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
138 institutions · 8 782 of 9 187 vouchered records shown · 393 without an institution code
09Environmental DNA10 detections
Where the DNA of Senecio nemorensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.7 °C 8.50–20.2
Seasonal swing summer↔winter26.5 °C
Max temp (day)22.2 °C 12.6–25.4
Min temp (night)11.6 °C 3.90–15.1
Precipitation43.9 mm/mo 24.3–67.6
Air humidity55.6 % 46.0–60.9
Moisture balance-63.5 mm/mo -100–-22.3
Vapour deficit895 Pa 466–1,274
Wind speed3.00 m/s 2.40–4.30
Cloud cover36.3 % 31.5–49.3
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.