Senecio maritimus

L.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Senecio

At a glance

Occurrence records230

Data sources6

Biological traits17

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Senecio maritimus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility230 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources17 traits

Chemical compositionNPASS53 compounds

Occurrence & distributionGBIF230 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI2.6 Gbp

01Narrative

Senecio maritimus adalah spesies tumbuhan yang tergolong ke dalam famili Asteraceae. Spesies ini juga merupakan bagian dari ordo Asterales. Spesies Senecio maritimus sendiri merupakan bagian dari genus Senecio. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh L.f..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology5

Plant height max0.44 m

Plant height min0.15 m

Seed mass0.35 mg

Seed mass max0.34 mg

Seed mass min0.34 mg

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max15 m

Elevation min2 m

Epiphyteterrestrial

Growth formherb

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition53 compounds

Compounds documented for Senecio maritimus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids11

Guaiane sesquiterpenoids8

Linear diarylheptanoids5

Pyrrolizidine alkaloids4

Bisabolane sesquiterpenoids3

Documented compounds53 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-alpha-Curcumene	present	NPASS
(-)-Camphene	present	NPASS
(1E,4Z,6E)-5-hydroxy-1,7-bis(4-hydroxy-3-methoxyphenyl)hepta-1,4,6-trien-3-one	present	NPASS
(1R,4E,6S,7R,17S)-4-ethylidene-7-hydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione	present	NPASS
(1R,4Z,6R,7R,17S)-4-ethylidene-7-hydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione	present	NPASS
(1R,4Z,7R,17S)-4-ethylidene-7-hydroxy-7-methyl-6-methylidene-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione	present	NPASS
(1R,6E,10S)-6,10-dimethyl-3-propan-2-ylidene-11-oxabicyclo[8.1.0]undec-6-en-4-one	present	NPASS
(1S,3E,6E,10S)-3-(1-hydroxypropan-2-ylidene)-6,10-dimethyl-11-oxabicyclo[8.1.0]undec-6-en-4-one	present	NPASS
(2S,14Z,20Z)-tricosa-14,20-dien-3,5,10,12,22-pentayne-1,2-diol	present	NPASS
(3E,6E,10S)-3-(1-hydroxypropan-2-ylidene)-6,10-dimethylcyclodec-6-ene-1,4-dione	present	NPASS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio maritimus has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSEF538244.1 ↗706 bpNew Zealand

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGAACAACCAGCGAACATGTAAAAATATAAAGGCGTCCGTGG …

Jacobaea maritima voucher Macmillan BH 95/17 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Senecio maritimus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 552 580 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Senecio maritimus2.55 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.8% BUSCO

08Occurrence & distribution

Record type230 records

Wild obs. + sensor138

Museum / vouchered92

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 113≤1 km 9≤10 km 3

125 georeferenced · 13 without coordinates

Open the mapobservation + sensor138

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 12

12 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	37
Pretoria, ZA	31
South Kensington, GB	10
GHPG$location not on record	4
CICYTEXlocation not on record	3
MSB-3054location not on record	2
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	2
South African National Biodiversity Institutelocation not on record	1
Dresden, DE	1
College of the Atlantic, Museumlocation not on record	1

10 institutions · 92 of 92 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)