Senecio linearifolius

A.Rich. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Senecio

At a glance

Occurrence records8 994

Data sources11

Biological traits40

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Senecio linearifolius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 994 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources40 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF8 994 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 60

01Narrative

Senecio linearifolius adalah spesies tumbuhan yang tergolong ke dalam famili Asteraceae. Spesies ini juga merupakan bagian dari ordo Asterales. Spesies Senecio linearifolius sendiri merupakan bagian dari genus Senecio. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh A.Rich..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsTRY

Size & morphology16

Fruit length2 mm

⚠ sources differ — AusTraits: 2 mm · GIFT: 1 mm

Leaf length100 mm

Leaf length max140 mm

Leaf mass per area58.82 g/m2

Leaf size2 215 mm²

Leaf width15 mm

⚠ sources differ — AusTraits: 15 mm · GIFT: 6 mm

Leaf width max6 mm

Leaf width min6 mm

Plant height0.6 m

⚠ sources differ — GIFT: 0.6 m · AusTraits: 1.5 m · TRY: 1 m

Plant height max2 m

Plant height min0.5 m

Seed length2 mm

Seed mass0.24 mg

Seed mass max0.24 mg

Seed mass min0.24 mg

Seed width0.8 mm

Life cycle & reproduction10

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typewind

Flowering timeyyynnnnnnnyy

Life spanperennial

Lifespan years5 years

Pollination syndromeinsect

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: herb · TRY: H

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate linear narrowly_elliptical obovate

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · AusTraits: herbaceous woody · GIFT: non-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)18.27 mm²/mg

03Chemical composition6 compounds

Compounds documented for Senecio linearifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Eremophilane sesquiterpenoids1

Eremophilane sesquiterpenoids $ Valerane sesquiterpenoids1

Simple phenolic acids1

Aromadendrane sesquiterpenoids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-alpha-Gurjunene	present	LOTUS
(3S,4aR,5S)-4a,5-dimethyl-3-prop-1-en-2-yl-3,4,5,6,7,8-hexahydronaphthalen-2-one	present	LOTUS
3-Bromo-4,5-dihydroxylbenzyl methyl ether	present	NPASS
3-Bromo-5-(hydroxymethyl)benzene-1,2-diol	present	NPASS
5-Bromo-3,4-dihydroxybenzaldehyde	present	NPASS
Fukinone	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio linearifolius has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKC696064.1 ↗586 bpAustralia

ACGT

GCAGAACGACCTGTGAACATGTAACAACAATTGGGTGTTCTTTGTATCGGGCTCTTGTCCGATTCAAGGGATGCCATGTTGACGTGTGTC …

Senecio linearifolius internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Senecio linearifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome records60–602n range60median60mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 602×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Lawrence, M. E. 1980. Senecio L. (Asteraceae) in Australia: chromosome numbers and the occurrence of polyploidy. Austral. J. Bot. 28: 151–166.

CCDB · kew — Lawrence ME. 1985. Senecio L. (Asteraceae) in Australia - Nuclear DNA amounts. Australian Journal of Botany 33: 221-232.

n 301×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Lawrence, M. E. 1980. Senecio L. (Asteraceae) in Australia: chromosome numbers and the occurrence of polyploidy. Austral. J. Bot. 28: 151–166.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type8 994 records

Wild obs. + sensor8 745

Museum / vouchered248

Other1

Origin

Native73

Introduced8

Range

Area of Occupancy AOO19 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 6 797≤1 km 1 294≤10 km 208>10 km 58

8 357 georeferenced · 388 without coordinates

Open the mapobservation + sensor8 745

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 26≤1 km 54≤10 km 68>10 km 12

160 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence248

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	73
Museo Entomologico de Leonlocation not on record	17
QVMAGlocation not on record	16
Wollongong, AU	16
Hobart, AU	13
Batemans Bay, AU	13
Stockholm, SE	13
Canberra, AU	9
Claremont, US	8
Riverside, US	7
Adelaide, AU	7
Kew, GB	7
Brisbane, AU	6
Parkville, AU	5
John T. Waterhouse Herbariumlocation not on record	5
Armidale, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4
La Trobe Universitylocation not on record	4
Honolulu, US	3
San Diego, US	3
Auckland, NZ	2
Christchurch, NZ	2
CASlocation not on record	1
Irvine, US	1
Canadian Department of Agriculturelocation not on record	1
Museo Achille Folettolocation not on record	1
Guangzhou, CN	1
EL PASO, US	1

28 institutions · 244 of 248 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Senecio linearifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Riparian, with Baccharis salicifolia, Salix …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 19.0–19.0

Seasonal swing summer↔winter7.40 °C

Max temp (day)22.9 °C

Min temp (night)15.7 °C

Precipitation13.5 mm/mo

Air humidity61.0 %

Moisture balance-62.4 mm/mo

Vapour deficit857 Pa

Wind speed1.00 m/s

Cloud cover17.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Senecio linearifolius

At a glance

Sources11 archives

Size & morphology16

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Compound class profile4 classes

Documented compounds6 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type8 994 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 994 records