Senecio keniophytum — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Senecio

At a glance

Occurrence records29

Data sources7

Biological traits2

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Senecio keniophytum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF29 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Atop of Mount Kenya Senecio keniophytum is one of the endemic groundsel (Senecio) found at high altitudes in Kenya, such as the Afro-alpine zone of Mount Kenya, but not one of the giant Dendrosenecio that also live there.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFT

Habitat & environment2

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio keniophytum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSKX494560.1 ↗588 bp

ACGT

TGTTGGGCTCTTGTCCGATTCTTAGGATGCCATGTTGACCTGCGTCTTTGGCAAGACCCTTGGGTTTTCTAAGGACGTCCTGTCGACACA …

Senecio keniophytum isolate 4.3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Senecio keniophytum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type29 records

Wild obs. + sensor4

Museum / vouchered25

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3≤10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 3≤10 km 20

23 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	25

1 institutions · 25 of 25 vouchered records shown