Senecio ilicifolius

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Senecio

At a glance

Occurrence records240

Data sources8

Biological traits15

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Senecio ilicifolius's data was compiled from.

GBIFGlobal Biodiversity Information Facility240 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources15 traits

Chemical compositionNPASS26 compounds

Occurrence & distributionGBIF240 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesGIFTTRY

Size & morphology5

Plant height max1 m

Plant height min0.3 m

Seed mass0.3 mg

Seed mass max0.3 mg

Seed mass min0.3 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max700 m

Elevation min5 m

Epiphyteterrestrial

Growth formshrub

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: woody

Other traits1

Plant support typefree-standing

03Chemical composition26 compounds

Compounds documented for Senecio ilicifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Secoiridoid monoterpenoids17

Cinnamic acids and derivatives $ Phenylethanoids3

Iridoids monoterpenoids $ Secoiridoid monoterpenoids2

Menthane monoterpenoids1

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,5S,6E,7S,14R,15S,16S,17R)-6-ethylidene-16-(hydroxymethyl)-14,17-dimethyl-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,8,12-trioxatricyclo[13.2.1.05,10]octadec-9-ene-3,11-dione	present	NPASS
(4S,5E,6S)-5-ethylidene-4-[2-[(1S,2R,3S,4S)-3-[[2-[(2S,3E,4S)-3-ethylidene-5-methoxycarbonyl-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4H-pyran-4-yl]acetyl]oxymethyl]-4-[(2S)-1-hydroxypropan-2-yl]-2-methylcyclopentyl]oxy-2-oxoethyl]-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4H-pyran-3-carboxylic acid	present	NPASS
(5R,6S,8S,9R,10S,15S,16E,17S)-16-ethylidene-8-hydroxy-5,9-dimethyl-17-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,12,18-trioxatricyclo[13.4.0.06,10]nonadec-1(19)-ene-2,13-dione	present	NPASS
[(2R,3R,4R,5R,6R)-2-[[(2R,3R,4S)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxymethyl]-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-4-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
[(2R,3R,4R,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2-[[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
GCVHEYYKXYZLNQ-SHILESBBSA-N	present	NPASS
IVSNJPCWTDNKHQ-UOFHYGTESA-N	present	NPASS
LQGIUKGEJMQURS-KXHDFOTPSA-N	present	NPASS
methyl (4S,5E,6S)-4-[2-[[(2R,3R,4R,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-3-[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy-5-hydroxy-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]methoxy]-2-oxoethyl]-5-ethylidene-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4H-pyran-3-carboxylate	present	NPASS
methyl (4S,5E,6S)-5-ethylidene-4-[2-[(1S,2R,3S,4S)-3-(hydroxymethyl)-4-[(2S)-1-hydroxypropan-2-yl]-2-methylcyclopentyl]oxy-2-oxoethyl]-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4H-pyran-3-carboxylate	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio ilicifolius has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU818662.1 ↗739 bpSouth Africa

ACGT

AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACCTGTGAACATGTAACAACAAT …

Senecio ilicifolius isolate 1548 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type240 records

Wild obs. + sensor235

Museum / vouchered4

Cultivated / captive1

Range

Area of Occupancy AOO544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 180≤1 km 14≤10 km 3

197 georeferenced · 38 without coordinates

Open the mapobservation + sensor235

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence4

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	1
Bern, CH	1

2 institutions · 2 of 4 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Senecio ilicifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–18.8

Seasonal swing summer↔winter15.6 °C

Max temp (day)26.6 °C

Min temp (night)11.7 °C

Precipitation34.5 mm/mo

Air humidity48.3 %

Moisture balance-98.6 mm/mo

Vapour deficit1,186 Pa

Wind speed2.90 m/s

Cloud cover16.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)