Senecio distalilobatus

I.Thomps. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Senecio

At a glance

Occurrence records211

Data sources4

Biological traits19

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Senecio distalilobatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility211 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Occurrence & distributionGBIF211 records

DNA & barcodingNCBIsequences

01Narrative

Senecio distalilobatus adalah spesies tumbuhan yang tergolong ke dalam famili Asteraceae. Spesies ini juga merupakan bagian dari ordo Asterales. Spesies Senecio distalilobatus sendiri merupakan bagian dari genus Senecio. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh I.Thomps..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsGIFT

Size & morphology5

Fruit length2.4 mm

Leaf length90 mm

Leaf width27.5 mm

Plant height1.5 m

Plant height max1.5 m

Life cycle & reproduction7

Dispersal typewind

Flowering timeyyynnnnnnyyy

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typegynomonoecious

Habitat & environment5

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf shapeoblong obovate triangular

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio distalilobatus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON759055.1 ↗722 bpAustralia

ACGT

AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACCTGTGAACATGTAACAACAATTGGGTG …

Senecio distalilobatus voucher CANB952367 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type211 records

Wild obs. + sensor127

Museum / vouchered84

Origin

Native14

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 80≤1 km 15≤10 km 11

106 georeferenced · 21 without coordinates

Open the mapobservation + sensor127

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 20≤1 km 19≤10 km 29>10 km 8

76 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	35
Canberra, AU	17
Mount Annan, AU	14
Armidale, AU	12
Brisbane, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Wollongong, AU	1

7 institutions · 84 of 84 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)