Senecio aphanactis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Senecio

At a glance

Occurrence records262

Data sources10

Biological traits8

DNA specimens4

eDNA detections3

Sources10 archives

Databases and archives Senecio aphanactis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF262 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Senecio aphanactis, known by the common names chaparral ragwort, rayless ragwort, and California groundsel, is a species of flowering plant in the aster family.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Senecio aphanactis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF457430.1 ↗644 bpUSA

ACGT

TCGAAACCTGCATAGCAGAACGACCTGTGAACATGTAACAACAATCGGGTGTTCTAAGTGTCGGGCTCTTGTCCGATTCCTAGGATGCCA …

Senecio aphanactis internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcLaITS2ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Senecio aphanactis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Ornduff et al. 1963

n 201×CCDB · Cave1963

CCDB · Cave1963 — Ornduff et al. 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type262 records

Wild obs. + sensor25

Museum / vouchered231

Other6

Origin

Native21

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 17

17 georeferenced · 8 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 74≤1 km 37≤10 km 33>10 km 5

149 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence231

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	47
Claremont, US	30
Santa Barbara, US	27
San Luis Obispo, US	14
Austin, US	13
Riverside, US	11
CASlocation not on record	9
University of Stellenboschlocation not on record	9
San Francisco, US	6
Mexico City, MX	6
Irvine, US	4
Davis, US	4
US	4
Severin-McDaniel Insect Collectionlocation not on record	3
EL PASO, US	3
Bronx, US	3
Ensenada, MX	3
Mexico City, MX	3
Ann Arbor, US	3
Calabar, NG	2
Los Angeles, US	2
Austin, US	1
Zapopan, MX	1
Northridge, US	1
Pomona Collegelocation not on record	1
San Diego Natural History Museumlocation not on record	1
Hermosillo, MX	1
Arizona State University Biocollectionslocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Bloomington, US	1
Santa Cruz, US	1
Albuquerque, US	1
ASUlocation not on record	1
The University of Arizonalocation not on record	1

34 institutions · 219 of 231 vouchered records shown · 12 without an institution code

09Environmental DNA3 detections

Where the DNA of Senecio aphanactis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Chaparral with Adenostoma fasciculatum, Hete…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter9.50 °C

Max temp (day)20.0 °C

Min temp (night)10.8 °C

Precipitation26.0 mm/mo

Air humidity61.0 %

Moisture balance-93.5 mm/mo

Vapour deficit677 Pa

Wind speed1.70 m/s

Cloud cover26.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.