Sempervivum marmoreum

Griseb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Sempervivum

At a glance

Occurrence records187

Data sources10

Biological traits9

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Sempervivum marmoreum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF187 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 34

01Narrative

Sempervivum marmoreum is a succulent plant in the family Crassulaceae native to south-eastern Europe (Bulgaria, Romania, Greece, North Macedonia, Serbia, etc.) and central Europe (Hungary, Slovakia). Sempervivum marmoreum naturally grows on rocky outcrops with southern exposure.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.049 mg

Life cycle & reproduction3

Life formsucculent perennial

Life spanperennial

Raunkiær life formchamaephyte

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition4 compounds

Compounds documented for Sempervivum marmoreum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Kaempferol	present	LOTUS
Myricetin	present	LOTUS
Pollenin A	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sempervivum marmoreum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE999699.1 ↗608 bp

ACGT

TCGAAGCCTAGAAAGCACGACCGCGAACGAGTTTCTTTTCGAGAAGCGAGGGGAAACCCTCGGGCATCCCTTTGCTTCCTCGCTCGGCAG …

Sempervivum marmoreum subsp. reginae-amaliae genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher Stephenson LJUBOTIH

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS9

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sempervivum marmoreum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome records34–682n range34median34mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 347×CCDB · iapt · CCDB · fl-europaea · CCDB · ipcn-api-dl

CCDB · iapt — IAPT/IOPB Chromosome Data 13

CCDB · fl-europaea — Zesiger, ined

CCDB · ipcn-api-dl — Hart, H. t. & J. C. V. LOON. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 362–363.

CCDB · ipcn-api-dl — Zésiger, F. 1982. In D.M. Moore, Flora Europaea Check-list and Chromosome Index.Cambridge Univ. Press. P. 74.

2n 681×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Letz, R., A. Uhríková & J. Májovský. 1999. Chromosome numbers of several interesting taxa of the flora of Slovakia. Biologia (Bratislava) 54: 43–49.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type187 records

Wild obs. + sensor157

Museum / vouchered24

Cultivated / captive6

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 69≤1 km 21≤10 km 7>10 km 43

140 georeferenced · 17 without coordinates

Open the mapobservation + sensor157

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 2≤10 km 2>10 km 2

6 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence24

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced · 1 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	3
BRNUlocation not on record	2
Moscow State Universitylocation not on record	2
MAlocation not on record	1
GJOlocation not on record	1
Olocation not on record	1
Chicago, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
LDlocation not on record	1

9 institutions · 13 of 24 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)