Sempervivum globiferum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Sempervivum

At a glance

Occurrence records3 715

Data sources7

Biological traits27

DNA specimens1

eDNA detections6

Sources7 archives

Databases and archives Sempervivum globiferum's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 715 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF3 715 records

Environmental DNA1 datasets · 4 countries6 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Plant height0.138 m

⚠ sources differ — GIFT: 0.138 m · TRY: 0.175 m

Plant height generative0.192 m

Plant height max0.4 m

Plant height min0.08 m

Seed length1 mm

Seed mass0.08 mg

Seed mass max0.076 mg

Seed mass min0.076 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal type detailedautochorous

Flowering endAug

Flowering startJul

Life formsucculent perennial

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formchamaephyte

Self fertilizationpresent

Habitat & environment6

Climatetemperate

Elevation max3 000 m

Elevation min1 100 m

Growth formherb

⚠ sources differ — GIFT: herb · TRY: succulent

Habitat GIFTforest, limestone, rivers, sand

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayCAM

Specific leaf area (SLA)7.23 mm²/mg

Other traits1

Diaspore typeseed

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sempervivum globiferum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections6

Countries4

The DNA barcodea real sequence read deposited for this species

ITSHE999697.1 ↗608 bp

ACGT

TCGAAGCCTAGAAAGCACGACCGCGAACGAGTTGCTATTCGCGAGAAGCGAGGGGAGACCCTCGGGCGTCCCTTCGTTTCTATGCTCGGC …

Sempervivum globiferum subsp. allionii genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher Stephenson 261

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS7

plant barcodefungal barcode

08Occurrence & distribution

Record type3 715 records

Wild obs. + sensor3 682

Museum / vouchered32

Cultivated / captive1

Origin

Introduced2

Range

Area of Occupancy AOO7 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 1 703≤1 km 259≤10 km 990>10 km 89

3 041 georeferenced · 641 without coordinates

Open the mapobservation + sensor3 682

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 3

11 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence32

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	6
LDlocation not on record	5
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	5
Uniwersytet Jagiellońskilocation not on record	2
Vancouver, CA	1
Chicago, US	1
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	1

7 institutions · 21 of 32 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Sempervivum globiferum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.50 °C 3.50–9.90

Seasonal swing summer↔winter20.6 °C

Max temp (day)11.3 °C 7.50–13.8

Min temp (night)2.50 °C -1.40–5.40

Precipitation84.0 mm/mo 58.5–114

Air humidity60.3 % 58.1–63.2

Moisture balance18.4 mm/mo -8.00–41.4

Vapour deficit472 Pa 339–556

Wind speed3.10 m/s 2.20–3.90

Cloud cover45.6 % 44.8–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sempervivum globiferum

At a glance

Sources7 archives

Size & morphology8

Life cycle & reproduction10

Habitat & environment6

Physiology & chemistry2

Other traits1

At a glance

Record type3 715 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions2 of 7 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 715 records