Sempervivum ciliosum

Craib · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Sempervivum

At a glance

Occurrence records50

Data sources10

Biological traits8

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Sempervivum ciliosum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility50 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF50 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Sempervivum ciliosum, the Teneriffe houseleek, is a species of flowering plant in the stonecrop family Crassulaceae, native to Southeastern Europe. Growing to just 10 cm high by 50 cm wide, it is a spreading evergreen perennial. It forms spheres of pointed, succulent, hairy grey-green leaves. Mature rosettes may produce yellowish flowers on stalks up to 10 cm in summer. Despite a superficial resemblance, houseleeks are not closely related to cacti. The Latin specific epithet ciliosum means “with a small fringe”. Sempervivum ciliosum has gained the Royal Horticultural Society’s Award of Garden Merit. Although hardy down to -20 C, it requires a sheltered position in full sun, in well-drained soil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formsucculent perennial

Life spanperennial

Raunkiær life formchamaephyte

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition4 compounds

Compounds documented for Sempervivum ciliosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Kaempferol	present	LOTUS
Myricetin	present	LOTUS
Pollenin A	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sempervivum ciliosum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX695975.1 ↗577 bpFrance · 2024

ACGT

CGAGTATCTTTTCGAGAAGCGAGGGGAAACCCTCGGGCATCCCTTTGCTTCCTCGCTCGGCAGGGGAAGGAGCCTTGCGCTCCATTCCCT …

Sempervivum ciliosum voucher S._Ci internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sempervivum ciliosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 341×CCDB · fl-europaea

CCDB · fl-europaea — Zesiger, 1961

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type50 records

Wild obs. + sensor43

Museum / vouchered5

Cultivated / captive2

Origin

Introduced1

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 17≤1 km 4≤10 km 3>10 km 1

25 georeferenced · 18 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
BRNUlocation not on record	1
MAlocation not on record	1

2 institutions · 2 of 5 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Sempervivum ciliosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 12.9–12.9

Seasonal swing summer↔winter21.4 °C

Max temp (day)17.2 °C

Min temp (night)7.00 °C

Precipitation50.9 mm/mo

Air humidity55.4 %

Moisture balance-28.5 mm/mo

Vapour deficit759 Pa

Wind speed2.00 m/s

Cloud cover39.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)