Sempervivum calcareum

Jord. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Sempervivum

At a glance

Occurrence records3 825

Data sources9

Biological traits5

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Sempervivum calcareum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 825 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF3 825 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 38

01Narrative

Sempervivium calcareum, the houseleek, is a species of flowering plant in the stonecrop family Crassulaceae, native to the southern Alps in Europe. An evergreen succulent perennial, it has a rosette with thick leaves that store water. The leaves are usually green with reddish-purple tips. This plant reproduces with asexual budding and monocarpic sexual reproduction. Sempervivum calcareum is cultivated as an ornamental garden plant. It is suitable for a well-drained spot in full sun, such as a rockery. The cultivars ‘Extra’, ‘Guillaumes’ and 'Sir William Lawrence' have gained the Royal Horticultural Society’s Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Plant height0.2 m

Life cycle & reproduction2

Life formsucculent perennial

Life spanperennial

Habitat & environment1

Climatetemperate

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Sempervivum calcareum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Kaempferol		present	LOTUS
Myricetin		present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sempervivum calcareum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX695972.1 ↗592 bpFrance · 2024

ACGT

CGAGTTTCTATTCGAGAAGCGAAGGGAAACCCTTGGGCATCCCTTTGCTTCCTCTCTCGGCGGGGGAAGGAGCCTTGCACTCCACTCCCT …

Sempervivum calcareum voucher S._Cal1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sempervivum calcareum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–382n range38median38mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 385×CCDB · ita-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +1

CCDB · ita-fl — FAVARGER C., SCHERBATOFF M. - 1973. Sur une espce intressante des Alpes austro-occidentales: Sempervivum calcareum Jordan. Candollea , 28: 219-235.

CCDB · fl-europaea — Favarger &

CCDB · ipcn-api-dl — Favarger, C. & F. Zésiger. 1982. In D.M. Moore, Flora Europaea Check-list and Chromosome Index.Cambridge Univ. Press. P. 75.

CCDB · book-ipcn73-74 — FAVARGER, c., & M. SCHERBATOFF. 1973. sur une espece interessante des Alpes austro-occidentales: Sempervivum calcareum Jordan. Candollea 28: 219-235.

n 192×CCDB · ita-fl · CCDB · book-ipcn73-74

CCDB · ita-fl — FAVARGER C., SCHERBATOFF M. - 1973. Sur une espce intressante des Alpes austro-occidentales: Sempervivum calcareum Jordan. Candollea , 28: 219-235.

CCDB · book-ipcn73-74 — FAVARGER, c., & M. SCHERBATOFF. 1973. sur une espece interessante des Alpes austro-occidentales: Sempervivum calcareum Jordan. Candollea 28: 219-235.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type3 825 records

Wild obs. + sensor3 805

Museum / vouchered19

Cultivated / captive1

Range

Area of Occupancy AOO2 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 303≤1 km 72≤10 km 3 125>10 km 28

3 528 georeferenced · 277 without coordinates

Open the mapobservation + sensor3 805

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence19

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
BIO-UNIPIlocation not on record	11
Chongqing Museumlocation not on record	1

2 institutions · 12 of 19 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sempervivum calcareum

At a glance

Sources9 archives

Size & morphology1

Life cycle & reproduction2

Habitat & environment1

Other traits1

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 825 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Cultivated / Captivenot free-living

Record type3 825 records