Semljicola alticola

(Holm, 1950) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Semljicola

At a glance

Occurrence records69

Data sources8

Biological traits1

DNA specimens24

eDNA detections12

Sources8 archives

Databases and archives Semljicola alticola's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

World Spider Trait DBMasaryk University1 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources1 traits

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD24 specimens

01Narrative

Semljicola alticola is a spider species found in Sweden, Finland and Russia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesHyvärinen et al. 2019Henriksen & Hilmo 2015SLU 2020

Ecology1

Regional IUCN Red List categoryLeast Concern (LC)

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semljicola alticola has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

97Tvariable

166Tvariable

235Amostly conserved

259Amostly conserved

292Cvariable

298Avariable

307Avariable

319Avariable

412Gvariable

533Tmostly conserved

538Amostly conserved

553Tvariable

610Cvariable

ATTATATTTTATTTTTGGGGCATGAGCTGCTATAGTAGGGACAGCCATAAGAGTATTAATTCGAATTGAGTTAGGGCAAACTGGTAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes6

BINs2

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Semljicola arcticussame genus5.4%Semljicola latussame genus5.7%Semljicola obtusussame genus5.7%Gibothorax tchernovisame family6.4%Semljicola faustussame genus6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor5

Museum / vouchered64

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 20≤1 km 7≤10 km 20>10 km 4

51 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	39
SLU Artdatabankenlocation not on record	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Ekaterinburg, RU	3
Frankfurt am Main	1
Midt-Troms Museumlocation not on record	1

6 institutions · 58 of 64 vouchered records shown · 6 without an institution code

09Environmental DNA12 detections

Where the DNA of Semljicola alticola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

4. Native Grassland | 4.1. Tundra

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.20 °C 3.40–7.70

Seasonal swing summer↔winter29.8 °C

Max temp (day)9.20 °C 6.20–11.4

Min temp (night)4.40 °C 1.50–4.90

Precipitation41.8 mm/mo 21.5–70.4

Air humidity69.0 % 61.4–70.4

Vapour deficit297 Pa 230–405

Cloud cover62.9 % 60.1–73.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)