Semiricinula turbinoides

(Blainville, 1832) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Neogastropoda/Muricidae/Semiricinula

At a glance

Occurrence records341

Data sources8

Biological traits4

DNA specimens3

eDNA detections0

Sources8 archives

Databases and archives Semiricinula turbinoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility148 records↗

OBISOcean Biodiversity Information System193 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS341 records

DNA & barcodingBOLD3 specimens

01Narrative

Semiricinula turbinoides is a species of sea snail, a marine gastropod mollusk in the family Muricidae, the murex snails or rock snails.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max22 m

Depth min16 m

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semiricinula turbinoides has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

115Tvariable

220Cvariable

286Avariable

364Cvariable

370Tvariable

581Cvariable

646Cvariable

649Gvariable

TACGTTATATATTTTATTTGGAATGTGATCTGGTCTAGTAGGTACTGCCTTAAGCCTACTTATTCGAGCTGAATTAGGGCAACCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.81%

Haplotypes3

BIN1

Most divergent pair1.1%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Semiricinula tissotisame genus11.6%Euplica turturinasame order14.4%Plicopurpura columellarissame family14.9%Chicoreus brunneussame family15.0%Aporrhais pespelecanisame order15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type341 records

Wild obs. + sensor16

Museum / vouchered325

Range

Area of Occupancy AOO868 km²

Depth

0–200 m sunlit17

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.5 m · max 15 m · 17 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 5≤1 km 1>10 km 10

16 georeferenced

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 12≤1 km 97≤10 km 58>10 km 10

177 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence325

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	81
Santa Barbara Museum of Natural Historylocation not on record	21
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
University of Floridalocation not on record	5
Washington, US	4
Cambridge, US	2
Denver, US	2
Chongqing Museumlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Champaign, US	1
Delaware Museum of Nature and Sciencelocation not on record	1

12 institutions · 130 of 325 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)