Semiplotus modestus

Day, 1870 · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Semiplotus

At a glance

Occurrence records11

Data sources8

Biological traits5

DNA specimens3

eDNA detections6

Sources8 archives

Databases and archives Semiplotus modestus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF11 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD3 specimens

01Narrative

Semiplotus modestus is a species of cyprinid in the genus Semiplotus that inhabits India and upper Myanmar. Unsexed males have a maximum length of 20.0 cm and it is considered harmless to humans. It is classified as "data deficient" on the IUCN Red List.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length20 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semiplotus modestus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

34Avariable

CCTTTATCTCGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCCTTAAGCCTCCTTATTCGGGCTGAACTAAGCCAACCCGGGTCGCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Spinibarbus sinensissame family8.7%Spinibarbus denticulatussame family9.4%Schizothorax macropogonsame family9.7%Schizothorax nukiangensissame family9.9%Schizopyge nukiangensissame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type11 records

Wild obs. + sensor1

Museum / vouchered10

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	1

1 institutions · 1 of 10 vouchered records shown · 9 without an institution code

09Environmental DNA6 detections

Where the DNA of Semiplotus modestus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 17.9–24.3

Seasonal swing summer↔winter9.30 °C

Max temp (day)27.0 °C 24.8–29.2

Min temp (night)14.9 °C 10.2–19.5

Precipitation114 mm/mo 26.9–201

Air humidity58.0 % 52.8–63.2

Moisture balance-3.70 mm/mo -80.8–73.4

Vapour deficit1,041 Pa 964–1,118

Wind speed1.80 m/s 1.70–2.00

Cloud cover33.6 % 31.3–35.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)