Semiothisa cinerearia

Bremer & Grey, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Semiothisa

At a glance

Occurrence records79

Data sources6

Biological traits0

DNA specimens21

eDNA detections22

Sources6 archives

Databases and archives Semiothisa cinerearia's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF79 records

Environmental DNA1 datasets · 1 countries22 detections

DNA & barcodingBOLD21 specimens

01Narrative

Semiothisa cinerearia is a moth of the family Geometridae first described by Otto Vasilievich Bremer and Vasilii Fomich Grey in 1853. It is found in China and its major host plant is Styphnolobium japonicum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semiothisa cinerearia has left across the world's sequence archives.

At a glance

DNA specimens21

BINs3

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

14Amostly conserved

16Tmostly conserved

19Cmostly conserved

20Gmostly conserved

22Amostly conserved

34Tmostly conserved

49Amostly conserved

76Gmostly conserved

85Gmostly conserved

106Tmostly conserved

154Tmostly conserved

157Tmostly conserved

169Tmostly conserved

181Gmostly conserved

205Tmostly conserved

212Cmostly conserved

214Gmostly conserved

226Cmostly conserved

235Tmostly conserved

238Tmostly conserved

271Amostly conserved

274Amostly conserved

283Gmostly conserved

319Amostly conserved

325Amostly conserved

364Cmostly conserved

385Tmostly conserved

400Cmostly conserved

403Tmostly conserved

412Tmostly conserved

427Tmostly conserved

433Gvariable

436Amostly conserved

442Cmostly conserved

484Amostly conserved

500Cmostly conserved

505Cmostly conserved

517Amostly conserved

520Tmostly conserved

529Amostly conserved

533Tmostly conserved

556Tmostly conserved

562Amostly conserved

574Cmostly conserved

586Tmostly conserved

604Amostly conserved

607Cmostly conserved

610Cmostly conserved

622Tmostly conserved

640Tmostly conserved

641Cmostly conserved

646Tmostly conserved

652Cmostly conserved

655Amostly conserved

658Tmostly conserved

AACATTATATTTTATTTTCGGAATTTGAGCAGGTATAGTAGGAACCTCATTAAGATTATTAATTCGAGCAGAATTGGGTAACCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes7

BINs3

Most divergent pair1.4%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chiasmia cinereariasame family5.6%Gnopharmia colchidariasame family7.3%Munona iridescenssame order7.6%Thalathoides curtalissame order8.5%Leucanopsis flavorufasame order8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type79 records

Wild obs. + sensor75

Museum / vouchered4

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 31≤1 km 14≤10 km 1>10 km 1

47 georeferenced · 28 without coordinates

Open the mapobservation + sensor75

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ZSMlocation not on record	4

1 institutions · 4 of 4 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Semiothisa cinerearia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.3 °C 19.0–26.0

Seasonal swing summer↔winter28.8 °C

Max temp (day)27.1 °C 23.7–30.7

Min temp (night)16.8 °C 12.4–20.9

Precipitation72.5 mm/mo 48.6–161

Air humidity54.4 % 52.0–60.8

Moisture balance-64.6 mm/mo -124–16.5

Vapour deficit1,168 Pa 1,003–1,468

Wind speed3.20 m/s 2.40–4.00

Cloud cover33.8 % 31.4–36.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)