Semicossyphus reticulatus

(Valenciennes, 1839) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Labridae/Semicossyphus

At a glance

Occurrence records20

Data sources8

Biological traits5

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Semicossyphus reticulatus's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF20 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

The Asian sheepshead wrasse, Semicossyphus reticulatus, or the Kobudai, is a species of wrasse, one of the largest, native to the western Pacific Ocean, where it is only known from around the Korean Peninsula, China, Japan, and the Ogasawara Islands, where it inhabits rocky reef areas. It can reach 100 cm in total length and the greatest weight recorded for this species is 14.7 kg. This species is valued as a food fish in its native range. Asian sheepshead wrasse in captivity giving indication of size The Asian sheepshead wrasse, also known as kobudai in Japan, is a hermaphroditic species, meaning that it has both male and female organs which allows it to change its sex. The species gained media attention when the transformation was caught on camera by the BBC Earth crew while filming in the waters near Sado Island, Japan. In 2017, it was shown on the Blue Planet II episode "One Ocean". According to Great Big Story, Japanese diver Hiroyuki Arakawa has had a 30-year relationship with a sheepshead wrasse in Japan's Tateyama Bay, where he is the caretaker for an underwater Shinto shrine. He calls the fish, named "Yoriko", by hitting a bell on the underwater shrine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length100 cm

Body mass14 660 g

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability60

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semicossyphus reticulatus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes2

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.11%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

485Tvariable

GCGCTAAGTTTACTTATCCGGGCAGAACTAAGCCAACCTGGTGCTCTCCTTGGGGACGACCAAATTTATAATGTAATCGTTACGGCACAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Semicossyphus pulchersame genus5.9%Bodianus flavipinnissame family12.8%Bodianus frenchiisame family13.6%Bodianus flavifronssame family13.8%Bodianus anthioidessame family14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

07Deep time~4.16 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.16 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type20 records

Wild obs. + sensor2

Museum / vouchered18

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 2

4 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	5
Paris, FR	3
CASlocation not on record	3
Kagoshima University Museumlocation not on record	3
Cambridge, US	1
Ann Arbor, US	1
Chicago, US	1

7 institutions · 17 of 18 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Semicossyphus reticulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 12.9–16.1

Seasonal swing summer↔winter26.3 °C

Max temp (day)17.5 °C 16.6–18.3

Min temp (night)10.0 °C 7.90–12.1

Precipitation244 mm/mo 139–349

Air humidity62.2 % 58.9–65.6

Moisture balance154 mm/mo 48.1–260

Vapour deficit659 Pa 634–684

Wind speed2.70 m/s 2.50–2.90

Cloud cover38.1 % 35.7–40.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)