Semiarundinaria fastuosa

(Lat.-Marl. ex Mitford) Makino · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Semiarundinaria

At a glance

Occurrence records120

Data sources11

Biological traits19

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Semiarundinaria fastuosa's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility120 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF120 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Semiarundinaria fastuosa, the Narihira bamboo, Narihira cane or Narihiradake, is a species of flowering plant in the grass family Poaceae, native to Japan. Growing to 7 m tall by 2 m broad, it is a vigorous, evergreen bamboo with dark green cylindrical canes and dense tufts of lanceolate, glossy green leaves, up to 20 cm long. In cultivation it is useful as an architectural plant or screen. It has gained the Royal Horticultural Society's Award of Garden Merit. The specific epithet fastuosa is Latin for "proud".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length max130 mm

Leaf width15 mm

Leaf width max15 mm

Leaf width min15 mm

Plant height5 m

⚠ sources differ — GIFT: 5 m · TRY: 10 m

Plant height max6 m

Life cycle & reproduction6

Life formbamboo

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formphanerophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinesswoody

03Chemical composition6 compounds

Compounds documented for Semiarundinaria fastuosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cinnamic acids and derivatives3

Flavones1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
Coniferyl aldehyde	present	LOTUS
hydroquinone-O-β-D-glucopyranoside	present	LOTUS
Isoorientin 7-O-(6'''-O-(E)-feruloyl)glucoside	present	LOTUS
Koaburaside	present	LOTUS
Sinapaldehyde	present	LOTUS
trans-p-Coumaric acid	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semiarundinaria fastuosa has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences8

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ464843.1 ↗558 bp

ACGT

GGAAGGAGAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACTGGGCTCACGCCCGACCTCCAACCCTTTGTGAACC …

UNVERIFIED_ORG: Semiarundinaria fastuosa 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Semiarundinaria fastuosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records48–482n range48median48mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 485×CCDB · nw-europe-fl · CCDB · book-fedorov · CCDB · Cave1956supp

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4403

CCDB · book-fedorov — Tateoka. 1954

CCDB · book-fedorov — Janaki Ammal

CCDB · book-fedorov — I. 1964)

CCDB · Cave1956supp — Tateoka 1955

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type120 records

Wild obs. + sensor4

Museum / vouchered115

Cultivated / captive1

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 3≤10 km 1

7 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence115

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odawara, JP	26
KURAlocation not on record	17
Bronx, US	14
Nagano City, JP	9
Toyama, JP	6
Corvallis, US	6
Bando, JP	4
Canadian Department of Agriculturelocation not on record	3
Tsukuba, JP	3
WTUlocation not on record	2
Ashland, US	2
BIO-UNIPIlocation not on record	2
Christchurch, NZ	2
J.F.Oberlin Universitylocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Sagamihara, JP	1
Nagatoro-machi, Chichibu-gun, JP	1
Vancouver, CA	1
Brisbane, AU	1
Shinshu Universitylocation not on record	1
Kew, GB	1
Guangzhou, CN	1
Istituto Agrario Castelnuovolocation not on record	1
Taipei, TW	1
Taipei, TW	1
Sanda, JP	1
Nishihara, JP	1
Karlsruhe Institute of Technology, Botanical Gardenlocation not on record	1
Kochi, JP	1
Museum Of Natural And Environmental History, Shizuokalocation not on record	1

30 institutions · 115 of 115 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Semiarundinaria fastuosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 8.30–8.30

Seasonal swing summer↔winter17.7 °C

Max temp (day)11.9 °C

Min temp (night)4.60 °C

Precipitation58.1 mm/mo

Air humidity64.0 %

Moisture balance-4.10 mm/mo

Vapour deficit449 Pa

Wind speed3.70 m/s

Cloud cover41.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)