Semiardistomis viridis

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Semiardistomis

At a glance

Occurrence records837

Data sources8

Biological traits0

DNA specimens19

eDNA detections12

Sources8 archives

Databases and archives Semiardistomis viridis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility837 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF837 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD19 specimens

01Narrative

Semiardistomis viridis is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semiardistomis viridis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

184Gmostly conserved

263Cvariable

322Gmostly conserved

346Amostly conserved

439Gmostly conserved

481Gvariable

613Cmostly conserved

AACTTTATATTTTATTTTTGGAGCTTGATCTGGAATAGTAGGAACATCATTAAGAATGTTAATTCGAGCTGAATTAGGGAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paranchus albipessame family10.5%Omophron dentatumsame family11.9%Hydroporus longiusculussame order11.9%Hydroporus rufifronssame order12.2%Hydroporus appalachiussame order12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type837 records

Wild obs. + sensor224

Museum / vouchered613

Range

Area of Occupancy AOO968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 109≤1 km 29≤10 km 5>10 km 24

167 georeferenced · 57 without coordinates

Open the mapobservation + sensor224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 4≤1 km 7≤10 km 27>10 km 7

45 georeferenced · 568 without coordinates

Open the institutions mapphysical evidence613

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	431
College Station, US	76
OSUClocation not on record	30
CUlocation not on record	15
University Park, US	13
Royal Saskatchewan Museumlocation not on record	12
University of Alabamalocation not on record	8
Sam Noble Oklahoma Museum of Natural Historylocation not on record	5
Champaign, US	5
Provo, US	4
US	3
EWIClocation not on record	3
Chicago, US	2
Tempe, US	2
Wuzhou, CN	1
Cambridge, US	1
ASUlocation not on record	1
Colorado State Universitylocation not on record	1

18 institutions · 613 of 613 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Semiardistomis viridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

Muddy Shore of RiverpastureHayMud along a river

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.4–28.2

Seasonal swing summer↔winter11.5 °C

Max temp (day)31.1 °C 30.7–32.6

Min temp (night)20.9 °C 20.4–24.8

Precipitation98.2 mm/mo 70.0–140

Air humidity58.2 % 57.8–61.9

Moisture balance-77.5 mm/mo -106–-33.8

Vapour deficit1,372 Pa 1,339–1,476

Wind speed2.70 m/s 2.40–3.00

Cloud cover29.8 % 22.8–30.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)