Semiardistomis puncticollis

(Dejean, 1831) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Semiardistomis

At a glance

Occurrence records218

Data sources8

Biological traits0

DNA specimens64

eDNA detections67

Sources8 archives

Databases and archives Semiardistomis puncticollis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility218 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI67 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics64 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF218 records

Environmental DNA1 datasets · 1 countries67 detections

DNA & barcodingBOLD64 specimens

01Narrative

Semiardistomis puncticollis is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding64 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semiardistomis puncticollis has left across the world's sequence archives.

At a glance

DNA specimens64

BINs1

Marker genes1

eDNA detections67

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

34Amostly conserved

50Tmostly conserved

100Avariable

127Avariable

343Cvariable

346Gvariable

364Tmostly conserved

373Avariable

418Tmostly conserved

625Gmostly conserved

AACTTTATATTTTATTTTCGGAGCATGATCAGGAATAGTAGGAACATCATTAAGAATATTAATTCGAGCCGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes9

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pogonus gilvipessame family10.1%Pogonus littoralissame family10.4%Lionepha australerasasame family10.5%Lionepha erasasame family10.5%Hydroporus longiusculussame order10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type218 records

Wild obs. + sensor2

Museum / vouchered216

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 140≤10 km 4

144 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence216

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	175
University of Alberta Museums (UAM)location not on record	15
NEON Biorepository at Arizona State Universitylocation not on record	4
OSUClocation not on record	4
CUlocation not on record	3
National Ecological Observatory Network, United Stateslocation not on record	3
College Station, US	2
Essig Museum of Entomologylocation not on record	2
University Park, US	2
EWIClocation not on record	2
Carnegie Museum of Natural Historylocation not on record	1
Wuzhou, CN	1
ASUlocation not on record	1
Champaign, US	1

14 institutions · 216 of 216 vouchered records shown

09Environmental DNA67 detections

Where the DNA of Semiardistomis puncticollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found67

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 67 detections have coordinates

Open the map1 country0

woodyWetlandsdeciduousForestgrasslandHerbaceousevergreenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 23.0–27.5

Seasonal swing summer↔winter19.7 °C

Max temp (day)31.8 °C 28.8–33.0

Min temp (night)21.8 °C 17.9–23.2

Precipitation115 mm/mo 101–152

Air humidity59.2 % 56.7–61.5

Moisture balance-49.1 mm/mo -68.5–-9.70

Vapour deficit1,383 Pa 1,213–1,487

Wind speed2.40 m/s 1.60–4.00

Cloud cover31.3 % 25.6–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 67 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)