Semaprochilodus insignis

(Jardine, 1841) · species

image placeholder — illustration coming later

Animalia/Chordata/Characiformes/Prochilodontidae/Semaprochilodus

At a glance

Occurrence records429

Data sources10

Biological traits6

DNA specimens30

eDNA detections34

Sources10 archives

Databases and archives Semaprochilodus insignis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility429 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF429 records

Environmental DNA1 datasets · 1 countries34 detections

DNA & barcodingBOLD30 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

The kissing prochilodus or flag-tailed prochilodus (Semaprochilodus insignis) is a species of South American freshwater fish in the family Prochilodontidae. It is native to central and western parts of the Amazon basin. It is migratory, moving in large groups into whitewater rivers to spawn, afterwards returning to blackwater and clearwater rivers, as well as flooded forests.SeriouslyFish: Semaprochilodus insignis. Retrieved 4 March 2017.Lambert de Brito Ribeiro, M.; and M. Petrere Junior (1990). Fisheries ecology and management of the Jaraqui (Semaprochilodus taeniurus, S. insignis) in central Amazonia. River Research and Applications 5(3): 195–215. It is important in fisheries and sometimes seen in the aquarium trade, but require a relatively large tank. It can reach a maximum standard length of 27.5 cm and weight of 560 g. It resembles the other members of the genus Semaprochilodus, where most species are silvery with orange-red fins and a striped tail. Adult S. insignis lack the dark flank spots that can be seen in adult S. taeniurus, but both species have these spots as juveniles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length22 cm

Body mass560 g

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceminor commercial

Other traits1

Vulnerability25.99

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semaprochilodus insignis has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes2

eDNA detections34

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P590 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

200Gmostly conserved

473Tmostly conserved

CAGCCCTTAGCCTTTTGATTCGAGCGGAGCTCAGCCAACCCGGATCCCTACTGGGCGATGACCAGATTTATAATGTTATTGTTACCGCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes4

BIN1

Most divergent pair0.34%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Semaprochilodus variisame genus10.0%Prochilodus costatussame family10.0%Prochilodus lineatussame family10.2%Semaprochilodus taeniurussame genus10.5%Prochilodus argenteussame family10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Semaprochilodus insignis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 178 126 082 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Semaprochilodus insignis1.18 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time~0.9 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0.9 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type429 records

Wild obs. + sensor27

Museum / vouchered402

Origin

Native1

Range

Area of Occupancy AOO800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 6≤1 km 2≤10 km 1>10 km 6

15 georeferenced · 12 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 18≤10 km 138>10 km 61

217 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence402

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	154
Cambridge, US	45
Museu de Zoologia da Universidade de Sao Paulolocation not on record	37
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	31
USP-RPlocation not on record	22
University of Nebraskalocation not on record	20
CASlocation not on record	14
Chicago, US	9
Geneva, CH	8
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
Stockholm, SE	6
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	6
Museu Paraense Emílio Goeldilocation not on record	5
PUC-RSlocation not on record	5
Universidad del Tolima (UT)location not on record	4
Montgomery, US	3
CIRA-UNANlocation not on record	3
Ann Arbor, US	3
UNICAMPlocation not on record	3
Oregon State Universitylocation not on record	2
Toronto, CA	2
Washington, US	2
INMAlocation not on record	1
Louisiana State University, Museum of Zoologylocation not on record	1
	1
Paris, FR	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
FishBaselocation not on record	1
UEMlocation not on record	1
Universidad de los Llanos (UniLlanos)location not on record	1

30 institutions · 398 of 402 vouchered records shown · 4 without an institution code

09Environmental DNA34 detections

Where the DNA of Semaprochilodus insignis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 26.5–27.5

Seasonal swing summer↔winter1.50 °C

Max temp (day)29.7 °C 29.1–30.4

Min temp (night)24.2 °C

Precipitation187 mm/mo 84.8–290

Air humidity67.1 % 65.7–68.6

Moisture balance38.4 mm/mo -72.6–149

Vapour deficit1,172 Pa 1,086–1,258

Wind speed2.60 m/s 2.50–2.70

Cloud cover36.2 % 32.2–40.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)