Selysiothemis nigra

(Vander Linden, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Libellulidae/Selysiothemis

At a glance

Occurrence records2 350

Data sources7

Biological traits0

DNA specimens7

eDNA detections9

Sources7 archives

Databases and archives Selysiothemis nigra's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 350 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 350 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD7 specimens

01Narrative

Selysiothemis nigra, the black pennant, is a monotypic species of dragonfly in the family Libellulidae. It occurs in Central Asia and the Middle East. In Europe it is mostly confined to the coastal areas of the Mediterranean and the Black Sea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Selysiothemis nigra has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

132Cvariable

217Tvariable

634Tvariable

AACTCTATACTTAATCTTTGGAGCATGAGCAGGAATAATTGGGACAGCTTTAAGTGTCTTAATTCGAATTGAATTAGGTCAACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Somatochlora minorsame order13.2%Micrathyria ocellatasame family13.4%Somatochlora walshiisame order13.5%Urothemis assignatasame family13.7%Somatochlora albicinctasame order13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 350 records

Wild obs. + sensor2 325

Museum / vouchered21

Other4

Origin

Native94

Range

Area of Occupancy AOO5 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 940≤1 km 393≤10 km 91>10 km 39

1 463 georeferenced · 862 without coordinates

Open the mapobservation + sensor2 325

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Barcelona, ES	5
National Museums of Kenyalocation not on record	3
University of Milano Bicoccalocation not on record	2
Private Collection of Giacomo Assandrilocation not on record	1
Tartu, EE	1
Washington, US	1
Bonn, DE	1

7 institutions · 14 of 21 vouchered records shown · 7 without an institution code

09Environmental DNA9 detections

Where the DNA of Selysiothemis nigra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 16.1–37.6

Seasonal swing summer↔winter27.0 °C

Max temp (day)25.7 °C 18.5–44.4

Min temp (night)13.9 °C 13.0–29.8

Precipitation20.5 mm/mo 0.1–46.1

Air humidity46.1 % 29.3–59.0

Moisture balance-80.5 mm/mo

Vapour deficit1,245 Pa 817–4,570

Wind speed3.60 m/s

Cloud cover26.2 % 6.80–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Selysiothemis nigra

At a glance

Sources7 archives

At a glance

Record type2 350 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 350 records