Selidosema brunnearia

(Villers, 1789) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Selidosema

At a glance

Occurrence records4 547

Data sources8

Biological traits2

DNA specimens32

eDNA detections36

Sources8 archives

Databases and archives Selidosema brunnearia's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 547 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 547 records

Environmental DNA1 datasets · 7 countries36 detections

DNA & barcodingBOLD32 specimens

01Narrative

Selidosema brunnearia, the bordered grey, is a moth of the family Geometridae. The species was first described by Charles Joseph Devillers in 1789. It is found in central and southern Europe, Asia Minor, Transcaucasia and North Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Selidosema brunnearia has left across the world's sequence archives.

At a glance

DNA specimens32

BINs3

Marker genes1

eDNA detections36

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

43Gvariable

82Cmostly conserved

118Tmostly conserved

136Tmostly conserved

163Tmostly conserved

235Tmostly conserved

286Cvariable

289Amostly conserved

334Gmostly conserved

340Cvariable

400Cvariable

409Amostly conserved

421Tmostly conserved

436Tmostly conserved

514Amostly conserved

580Amostly conserved

595Tmostly conserved

604Tmostly conserved

610Tmostly conserved

628Amostly conserved

634Cmostly conserved

643Cmostly conserved

655Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGGACTTCTTTAAGATTATTAATTCGTGCAGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes4

BINs3

Most divergent pair2.6%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Selidosema plumariasame genus1.5%Selidosema parenzanisame genus2.3%Selidosema combustariasame genus2.9%Selidosema taeniolariasame genus3.2%Selidosema ambustariasame genus3.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 547 records

Wild obs. + sensor3 165

Museum / vouchered1 376

Other6

Origin

Native400

Range

Area of Occupancy AOO4 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 811≤1 km 521≤10 km 1 351>10 km 7

2 690 georeferenced · 475 without coordinates

Open the mapobservation + sensor3 165

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 200≤1 km 276≤10 km 829

1 305 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence1 376

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	667
Zürich, CH	121
Bern, CH	105
Tartu, EE	50
SLU Artdatabankenlocation not on record	32
Geneva, CH	26
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	22
Dhaka, BD	22
Fribourg, CH	17
Frauenfeld, CH	14
MZLUlocation not on record	13
Nijmegen, NL	11
John May Museum of Natural Historylocation not on record	11
Adam Mickiewicz University in Poznańlocation not on record	11
Podgorica, ME	10
Naturmuseum Solothurnlocation not on record	8
DABUHlocation not on record	8
SFRAlocation not on record	7
Archäologie und Museum Baselland - Museum.BLlocation not on record	7
NHMOlocation not on record	7
ZSMlocation not on record	5
Stockholm, SE	5
South Kensington, GB	5
MUZOO - Musée d'histoire naturelle de La Chaux-de-Fondslocation not on record	4
Glarus, CH	3
Naturama Aargaulocation not on record	3
Tallinn, EE	2
Paro, BT	2
Bavarian State Collection of Zoologylocation not on record	2
Musee d'Histoire Naturallelocation not on record	2
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Research Collection of Bernd Muellerlocation not on record	1
Provincia di Livornolocation not on record	1

34 institutions · 1 206 of 1 376 vouchered records shown · 170 without an institution code

09Environmental DNA36 detections

Where the DNA of Selidosema brunnearia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 15.3–20.4

Seasonal swing summer↔winter16.3 °C

Max temp (day)22.7 °C 19.1–25.7

Min temp (night)14.2 °C 11.5–16.2

Precipitation59.4 mm/mo 25.0–78.0

Air humidity57.2 % 51.8–60.6

Moisture balance-57.9 mm/mo -120–-17.0

Vapour deficit914 Pa 673–1,105

Wind speed2.60 m/s 2.10–3.70

Cloud cover33.8 % 23.4–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Selidosema brunnearia

At a glance

Sources8 archives

Diet & foraging2

At a glance

Record type4 547 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 547 records