Sedum album
speciesAt a glance
Occurrence records238 455
Data sources12
Biological traits54
DNA specimens16
eDNA detections10
Sources12 archives
Databases and archives Sedum album's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility238 455 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics16 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources54 traits
Chemical compositionLOTUS21 compounds
Occurrence & distributionGBIF238 455 records
Environmental DNA1 datasets · 3 countries10 detections
DNA & barcodingBOLD · NCBI16 specimens
Genome at a glanceCCDB · GoaT · NCBI499 Mbp
01Narrative
L'Orpin blanc, aussi appelé Sédum blanc, est une espèce de plantes à fleurs de la famille des Crassulacées. C'est une plante vivace originaire de l'Ancien Monde.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVPAusTraits
Size & morphology19
Fruit length2.75 mm
Leaf length8 mm
Leaf length max12 mm
Leaf length min4 mm
Leaf mass1.63 mg
Leaf size32 mm²
⚠ sources differ — TRY: 32 mm² · LEDA: 23.5 mm² · GIFT: 23.5 mm²
Leaf width3 mm
Leaf width max3 mm
Leaf width min3 mm
Plant height0.102 m
Plant height generative0.1 m
Plant height max0.2 m
Plant height min0.05 m
Seed length0.88 mm
Seed length max0.9 mm
Seed length min0.9 mm
Seed mass0.03 mg
⚠ sources differ — TRY: 0.03 mg · LEDA: 0.02 mg · GIFT: 0.025 mg
Seed mass max0.04 mg
Seed mass min0.02 mg
Life cycle & reproduction14
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: unspecialized
Flowering endJul
Flowering startJun
Life formsucculent subshrub
Life spanperennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Reproduction asexualabsent
Seed number80
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typefollicle
⚠ sources differ — AusTraits: follicle · GIFT: capsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: shrub · TRY: forb-succulent
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf shapelinear terete
Mycorrhiza typearbuscular
Woodinessnon-woody
⚠ sources differ — TRY: non-woody · AusTraits: semi_woody woody · LEDA: non-woody · GIFT: non-woody
Physiology & chemistry7
Leaf C:N ratio34.83 g/g
Leaf c403 mg/g
Leaf dry-matter content (LDMC)69.02 mg/g
⚠ sources differ — TRY: 69.02 mg/g · LEDA: 49.96 mg/g
Leaf n11.57 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)15.12 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition21 compounds
Compounds documented for Sedum album across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Flavonols20
Phenylethylamines1
Documented compounds21 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[3,5,7-trihydroxy-2-(4-hydroxyphenyl)-4-oxochromen-8-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[3,5,7-trihydroxy-2-(4-hydroxyphenyl)-4-oxochromen-8-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| 2-Phenylethylamine | present | LOTUS | |
| 5-hydroxy-2-(4-hydroxy-3-methoxyphenyl)-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 5-hydroxy-2-(4-hydroxy-3-methoxyphenyl)-7-[(2S,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 7-[(2S,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-2-(4-hydroxy-3-methoxyphenyl)-3-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 7-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,5-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)chromen-4-one | present | LOTUS | |
| 7-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-2-(4-hydroxy-3-methoxyphenyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one | present | LOTUS | |
| Gossypetin | present | LOTUS | |
| Hibifolin | present | LOTUS |
05DNA & barcoding16 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sedum album has left across the world's sequence archives.
At a glance
DNA specimens16
Marker genes5
GenBank sequences10
eDNA detections10
Countries4
The DNA barcodea real sequence read deposited for this species
GCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCATGCACTGCGATGCCCCCCGCCCAAGCGCGGGGAGCGAAGCCTGGCCTC …
Sedum album voucher 35277HIM 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Sedum album carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size498 780 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sedum album0.50 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 68 n = 34
Ploidy2× diploid · measured
Chromosome records18–1362n range68median68mode43records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6823×CCDB · ita-fl · CCDB · slov-fl · CCDB · iber-fl +4
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · ita-fl — LOEVE A. - 1968. IOPB chromosome number reports XVI.. Taxon , 17(2): 199-204.
CCDB · ita-fl — Hebert L.P. - 1976. La phytogographie dynamique et la cytotaxinomie de quelques espces de Sedum en Corse. Biol. Ecol. Mdit. , 3(3): 65-70.
CCDB · slov-fl — Uhríková A. & Májovský J., 1980: [Report], pp. 725-726. - In: Löve Á. (ed.), Chromosome number reports LXIX, Taxon 29 /5-6.
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 16-37. Queirs, M.Bol. Soc. Brot. ser. 253: 5-28(1979).
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 38-63. Queirs, M.Bol. Soc. Brot. ser. 254: 47-64(1980).
CCDB · fl-europaea — Uhl, 1961
CCDB · ipcn-api-dl — Queiros, M. 1980. Números cromosómicos para la Flora Portuguesa, 38-63. Bol Soc. Brot. ser. 2, 54: 47–64.
CCDB · ipcn-api-dl — Uhrikova, A. & J. Majovsky. 1980. In Chromosome number reports LXIX. Taxon 29: 725–726.
CCDB · ipcn-api-dl — Hart, H. t. & K. Alpinar. 1996. Biosystematic studies in Sedum (Crassulaceae) of Turkey. In M. A. Öztürk & al. (eds.), Plant Life in Southwest and Central Asia, 1: 71--99, Izmir.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J . & E. KLIPHUIS. 1968. In IOPB chromosome number reports XVI. Taxon 17: 199-204.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Cytotaxonomic investigations in some angiosperms collected in the Valley of Aosta and in the National Park "Gran Paradiso". Carylogia 23: 363-379.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., E. KLIPHUIS, & K.U. KRAMER. 1970. Zytotaxonomische Untersuchungen an Blutenpflanzen aus dem Osten Osterreichs. Wiss. Arbeiten Burgenland 44: 187-195.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1968b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XVI]. Taxon 17(2): 200-201.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1970b). Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park "Gran Paradisio". Caryologia 23: 363-379.
CCDB · CromoCat 2015 — Gadella, Th. W. J., Kliphuis, E. & Kramer, K. U. (1970). Zytotaxonomische untersuchungen an blutenpflanzen aus dem Osten Osterreichs. Wiss. Arbeiten Burgenland 44: 187-195.
CCDB · CromoCat 2015 — Hart, H. & Berg, A. J. (1982). The white flowered European Sedum species. 2. Cytotaxonomic notes on S. album L. and S. gypsicolum Boiss. & Reuter. Proc. Kon. Ned. Akad. Wetensch. 85(4):677-691.
CCDB · CromoCat 2015 — Hart, H. (1985a). Chromosome numbers in Sedum (Crassulaceae) from Greece. Willdenowia 15: 115-136.
CCDB · CromoCat 2015 — Hart, H. (1991). Evolution and classification of the European Sedum species (Crassulaceae). Fl. Medit. 1: 31-61.
CCDB · CromoCat 2015 — Queirós, M. (1979). Números cromossómicos para a flora portuguesa, 16-37. Bol. Soc. Brot. 53: 5-28.
CCDB · CromoCat 2015 — Queirós, M. (1980a). Números cromossómicos para a flora portuguesa, 38-63. Bol. Soc. Brot. 54: 47-64.
CCDB · CromoCat 2015 — Uhríková, A. & J. Májovsky. (1980b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 725-726.
2n 349×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · ipcn-api-dl +2
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Contribution la cytotaxonomie de genre Sedum L. Hebert, L.Bull. Soc. Neuchteloise Sci. Nat.98: 59-70(1975).
CCDB · iber-fl — Evolution and classification of the European Sedum species (Crassulaceae). Hart, H.'t.Fl. Mediterranea1: 31-61(1991).
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · kew — Hart H. 1991. Evolution and classification of the European Sedum species (Crassulaceae). Flora Mediterranea 1: 31-61.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Hart, H. (1985a). Chromosome numbers in Sedum (Crassulaceae) from Greece. Willdenowia 15: 115-136.
CCDB · CromoCat 2015 — Hart, H. (1991). Evolution and classification of the European Sedum species (Crassulaceae). Fl. Medit. 1: 31-61.
CCDB · CromoCat 2015 — Hebert, L. (1975). Contribution à la cytotaxonomie de genre Sedum L. Bull. Soc. Neuchât. Sci. Nat. 98: 59-70.
2n 363×CCDB · iber-fl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · iber-fl — Sur la caryologie de quelques plantes rcoltes pendant la III Reunion de Botanique Pninsulaire. Fernandes, A. & M. Queirs.Mem. Soc. Brot.21: 343-385(1971).
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1970-71. Sur la caryologie de quelque plantes recoltees pendant la Illeme reunion de botanique peninsulaire. Mem. Soc. Broteriana 21: 343-385.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971b). Sur la caryologie de quelques plantes récoltées pendant la IIIème Réunion de Botanique Péninsulaire. Mem. Soc. Brot. 21: 343-385.
2n 512×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hart, H. (1985a). Chromosome numbers in Sedum (Crassulaceae) from Greece. Willdenowia 15: 115-136.
CCDB · CromoCat 2015 — Hart, H. (1991). Evolution and classification of the European Sedum species (Crassulaceae). Fl. Medit. 1: 31-61.
2n 1362×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Uhl, 1961
CCDB · CromoCat 2015 — Hart, H. (1991). Evolution and classification of the European Sedum species (Crassulaceae). Fl. Medit. 1: 31-61.
2n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Hart, H. t. & K. Alpinar. 1991. Biosystematic studies in Sedum (Crassulaceae) of Turkey. 1. Notes on four hitherto little known species collected in the western part of Anatolia. Willdenowia 21: 143–156.
2n 321×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Baldwin, J. T. (1939). Certain cytophyletic relations of Crassulaceae Chron. Bot. 5: 415-417.
2n 561×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
2n 641×CCDB · book-fedorov
CCDB · book-fedorov — Baldwin 1935
2n 721×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Queirós, M. (1980a). Números cromossómicos para a flora portuguesa, 38-63. Bol. Soc. Brot. 54: 47-64.
2n 851×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hart, H. (1991). Evolution and classification of the European Sedum species (Crassulaceae). Fl. Medit. 1: 31-61.
2n 1021×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hart, H. (1991). Evolution and classification of the European Sedum species (Crassulaceae). Fl. Medit. 1: 31-61.
n 173×CCDB · iber-fl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · iber-fl — Contribution la cytotaxonomie de genre Sedum L. Hebert, L.Bull. Soc. Neuchteloise Sci. Nat.98: 59-70(1975).
CCDB · book-ipcn75-78 — Hebert 1977
CCDB · CromoCat 2015 — Hebert, L. (1975). Contribution à la cytotaxonomie de genre Sedum L. Bull. Soc. Neuchât. Sci. Nat. 98: 59-70.
n 342×CCDB · ita-fl · CCDB · CromoCat 2015
CCDB · ita-fl — Hbert L.P. - 1975. Contribution la cytotaxonomie du genre Sedum L.. Bull. Soc. Neuchateloise Sci. Nat. , 98: 59-70.
CCDB · CromoCat 2015 — Hebert, L. (1975). Contribution à la cytotaxonomie de genre Sedum L. Bull. Soc. Neuchât. Sci. Nat. 98: 59-70.
n 161×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hebert, L. (1975). Contribution à la cytotaxonomie de genre Sedum L. Bull. Soc. Neuchât. Sci. Nat. 98: 59-70.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelContig
Completeness91.5% BUSCO
08Occurrence & distribution
Record type238 455 records
Wild obs. + sensor232 442
Museum / vouchered4 128
Cultivated / captive12
Other1 873
Origin
Native6 293
Introduced5 598
Range
Area of Occupancy AOO263 932 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy39% within 1 km
≤100 m 49 450≤1 km 26 563≤10 km 118 557>10 km 1 310
195 880 georeferenced · 36 562 without coordinates
Open the mapobservation + sensor232 442
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 365≤1 km 917≤10 km 868>10 km 364
2 514 georeferenced · 1 614 without coordinates
Open the institutions mapphysical evidence4 128
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy10% within 1 km
≤100 m 1≤10 km 2>10 km 7
10 georeferenced · 2 without coordinates
Open the mapnot free-living12
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions103 of 182 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 418 |
| Helsinki, FI | 333 |
| Olocation not on record | 277 |
| MAlocation not on record | 169 |
| Oskarshamn, SE | 143 |
| Salzburg, AT | 121 |
| SLU Artdatabankenlocation not on record | 120 |
| MeiseBGlocation not on record | 112 |
| València, ES | 101 |
| Entomological Society of Latvialocation not on record | 95 |
| Trondheim, NO | 93 |
| Turku, FI | 74 |
| KMNlocation not on record | 73 |
| Bergen, NO | 61 |
| BClocation not on record | 54 |
| BDBClocation not on record | 50 |
| Tartu, EE | 44 |
| Tallinn, EE | 44 |
| Provincia di Livornolocation not on record | 43 |
| Oulu, FI | 39 |
| Badajoz, ES | 38 |
| College of the Atlantic, Museumlocation not on record | 36 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 35 |
| Madrid, ES | 33 |
| Vitoria, ES | 31 |
| Phyletisches Museum Jenalocation not on record | 30 |
| WTUlocation not on record | 28 |
| Brussel, BE | 28 |
| BFLlocation not on record | 27 |
| Uniwersytet Wrocławskilocation not on record | 27 |
| DBF-NHMDlocation not on record | 27 |
| Chicago, US | 26 |
| Granada, ES | 26 |
| Uppsala, SE | 26 |
| Moscow State Universitylocation not on record | 26 |
| San Sebastián, ES | 26 |
| Berlin, DE | 26 |
| Pamplona, ES | 26 |
| ISAlocation not on record | 25 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 24 |
| Salamanca, ES | 23 |
| Adam Mickiewicz University in Poznańlocation not on record | 23 |
| Barcelona, ES | 23 |
| CICYTEXlocation not on record | 22 |
| Bern, CH | 21 |
| Kuopio, FI | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 20 |
| Auckland, NZ | 19 |
| Philadelphia, US | 18 |
| Jyväskylä, FI | 18 |
| Christchurch, NZ | 18 |
| GJOlocation not on record | 18 |
| Görlitz, DE | 17 |
| Wlocation not on record | 16 |
| Jaén, ES | 16 |
| Zürich, CH | 15 |
| Córdoba, ES | 15 |
| Porrentruy, CH | 15 |
| Alicante, ES | 14 |
| TUR-Alocation not on record | 14 |
| St. Paul, US | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| South Kensington, GB | 12 |
| Corvallis, US | 12 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| Paris, FR | 10 |
| OLAlocation not on record | 10 |
| Museo Entomologico de Leonlocation not on record | 10 |
| Allentown, US | 10 |
| TROMlocation not on record | 9 |
| EEZA-CSIClocation not on record | 9 |
| Mount Annan, AU | 9 |
| Frankfurt am Main | 9 |
| BRNUlocation not on record | 9 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Zürich, CH | 8 |
| Ann Arbor, US | 8 |
| Saint Louis, US | 7 |
| BGBMlocation not on record | 7 |
| SWlocation not on record | 7 |
| Bourges, FR | 7 |
| BIO-UNIPIlocation not on record | 7 |
| Hobart, AU | 7 |
| Canberra, AU | 6 |
| Claremont, US | 6 |
| Porvoo, FI | 6 |
| SZUlocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| nbflocation not on record | 6 |
| Bronx, US | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 5 |
| Pamplona, ES | 5 |
| Tilburg, NL | 4 |
| Stockholm, SE | 4 |
| Uniwersytet Jagiellońskilocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Frauenfeld, CH | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Burlington, US | 4 |
| CJBGlocation not on record | 4 |
| Madison, US | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Victoria, CA | 4 |
| Mlocation not on record | 4 |
| Monastir, TN | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Rotorua, NZ | 3 |
| Wellington, NZ | 3 |
| CASlocation not on record | 3 |
| LfUlocation not on record | 3 |
| BSBIlocation not on record | 3 |
| Philadelphia, US | 3 |
| Glarus, CH | 3 |
| Dresden, DE | 3 |
| Riverside, US | 3 |
| Kew, GB | 3 |
| Tampa, US | 3 |
| Santa Barbara, US | 3 |
| BG-NMNHSlocation not on record | 3 |
| Davis, US | 2 |
| Nijmegen, NL | 2 |
| Namur, BE | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Portland, US | 2 |
| Adelaide, AU | 2 |
| National Museum Waleslocation not on record | 2 |
| UIBlocation not on record | 2 |
| Winterthur, CH | 2 |
| Provo, US | 2 |
| Salvador, BR | 2 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| Pullman, US | 2 |
| Rovaniemi, FI | 2 |
| Fulda, DE | 2 |
| Edinburgh, GB | 2 |
| San Diego, US | 2 |
| Moscow, US | 2 |
| Chongqing Museumlocation not on record | 2 |
| SNSNMClocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| Missoula, US | 1 |
| Logan, US | 1 |
| PrivatHerblocation not on record | 1 |
| Whitehorse, CA | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Los Angeles, US | 1 |
| Gijón, ES | 1 |
| Sion, CH | 1 |
| Durham, US | 1 |
| ESP003location not on record | 1 |
| Brisbane, AU | 1 |
| Göteborg, SE | 1 |
| Bloomington, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| GZUlocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Cambridge, US | 1 |
| Sevilla, ES | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Millersville, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Lausanne, CH | 1 |
| Boumlocation not on record | 1 |
| New Haven, US | 1 |
| PRClocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Beijing, CN | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Pocatello, US | 1 |
| Oswego, US | 1 |
| Xiamen, CN | 1 |
| DULlocation not on record | 1 |
| Vancouver, CA | 1 |
| Coimbra, PT | 1 |
| Université Lavallocation not on record | 1 |
| Fort Worth, US | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
182 institutions · 3 842 of 4 128 vouchered records shown · 278 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Sedum album was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map3 countries0
on road verge
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.80 °C 4.40–15.6
Seasonal swing summer↔winter12.4 °C
Max temp (day)12.4 °C 6.00–18.2
Min temp (night)6.30 °C 2.90–12.7
Precipitation77.6 mm/mo 66.9–116
Air humidity62.8 % 60.6–67.3
Moisture balance62.6 mm/mo
Vapour deficit425 Pa 304–673
Wind speed7.00 m/s
Cloud cover47.6 % 41.9–56.3
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.