Secale cereale
speciesAt a glance
Occurrence records27 044
Data sources14
Biological traits141
DNA specimens22
eDNA detections15
Sources14 archives
Databases and archives Secale cereale's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility27 044 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics22 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources141 traits
Chemical compositionFooDB · LOTUS · NPASS5 873 compounds
Occurrence & distributionGBIF27 044 records
Environmental DNA1 datasets · 3 countries15 detections
DNA & barcodingBOLD · NCBI22 specimens
Genome at a glanceCCDB · GoaT · NCBI8.9 Gbp
01Narrative
Le seigle est une plante annuelle du genre Secale appartenant à la famille des Poaceae (graminées) et cultivée comme céréale ou comme fourrage. Elle fait partie des céréales à paille. C'est une céréale rustique adaptée aux terres pauvres et froides. Sa culture reste importante dans l'Est de l'Europe, mais est devenue marginale ailleurs. Le genre Secale comprend de nombreuses espèces originaires d'Asie centrale.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTAusTraitsWCVPUSDA
Size & morphology25
Inflorescence length max15 cm
Inflorescence length min5 cm
Leaf length160 mm
Leaf length max300 mm
Leaf length min100 mm
Leaf size2 112 mm²
Leaf width10 mm
⚠ sources differ — AusTraits: 10 mm · GIFT: 11 mm
Leaf width max10 mm
Leaf width min5 mm
Plant height1.05 m
⚠ sources differ — GIFT: 1.05 m · AusTraits: 1.5 m · USDA: 1.07 m · TRY: 1.41 m
Plant height generative1.35 m
Plant height max2 m
Plant height min0.5 m
Seed length7 mm
Seed length max7 mm
Seed length min7 mm
Seed mass22.55 mg
⚠ sources differ — TRY: 22.55 mg · LEDA: 38.64 mg · GIFT: 28.19 mg
Seed mass max28.5 mg
Seed mass min14.47 mg
Seed volume21 mm³
Seed volume max21 mm³
Seed volume min21 mm³
Seed width2.5 mm
Seed width max2.5 mm
Seed width min2.5 mm
Life cycle & reproduction36
After harvest regrowth rateModerate
Bloom periodEarly Spring
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typeanimal
Flower colouryellow
Flower conspicuousNo
Flower length max15 mm
Flower length min8 mm
Flowering endJul
Flowering startJun
Flowering timennnnnnnnyyyn
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formannual or biennial
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityfire_killed
Seed spread rateSlow
Seedling vigorHigh
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment32
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min1 500 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterModerate
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Graminoid
Growth form USDABunch
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathYes
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapefalcate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min8 in
Shape and orientationErect
Small grainYes
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min100 days
Leaf dry-matter content (LDMC)141 mg/g
Leaf n26 mg/g
Leaf p2.38 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max50 in
Precipitation min11.5 in
Protein potentialMedium
Salinity toleranceMedium
Seed longevity index0
Shade toleranceHigh
Soil pH max7.85 pH
Soil pH min4.85 pH
Specific leaf area (SLA)32.01 mm²/mg
Temperature min-38 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound18 160 per lb
ToxicityNone
Veneer productNo
Other traits6
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencespike
03Chemical composition5 873 compounds
Compounds documented for Secale cereale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingCereals and cereal products
Compound class profile5 classes
Aminoacids275
Cinnamic acids and derivatives68
Glycerophospholipids57
Pyridine alkaloids48
pteridine alkaloids42
Documented compounds5 873 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| α-D-galactose | 62,300 mg/100g | FooDB | |
| Starch, pregelatinized | 62,300 mg/100 g | FooDB | |
| Sucrose | 5,640 mg/100 g | FooDB | |
| Sugars | 5,640 mg/100g | FooDB | |
| L-Glutamic acid | 3,886 mg/100g | FooDB | |
| Maltodextrin | 3,390 mg/100 g | FooDB | |
| Maltose | 3,390 mg/100g | FooDB |
05DNA & barcoding22 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Secale cereale has left across the world's sequence archives.
At a glance
DNA specimens22
Marker genes5
GenBank sequences10
eDNA detections15
Countries5
The DNA barcodea real sequence read deposited for this species
TTATGTGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGCAC …
Secale cereale voucher PRVJ-14D 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL5★rbcLa★ITS3
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Secale cereale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size8 875 350 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Secale cereale8.88 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–282n range14median14mode54records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1450×GoaT · Kew Plant DNA C-values Database · CCDB · iapt · CCDB · nw-europe-fl +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iapt
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4645
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Yuan, Y. M., Z. x. Peng & Y. g. Ren. 1988. Observations on chromosomes of some plants from Lanzhou and adjacent area. J. Northw. Teachers Coll., Nat. Sci. 1: 58–63.
CCDB · ipcn-api-dl — Chen, R. y. 1989. A further research of plant chromosome G-banding. Pp. 187--193 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Lu, Y. x. & Z. h. Zhou. 1987. A preliminary study on rye (Secale cereale) chromosome by silver staining. Acta Genet. Sin. 14: 344–348.
CCDB · ipcn-api-dl — Yao, J. x. & B. x. Cheng. 1985. Analysis on karyotype and C-banding pattern of Secale cereale L. s.l. Zuown Pinzhong Ziyuan (Crop Variety Resources). 4: 19–21.
CCDB · ipcn-api-dl — Zhang, Z. l. & X. f. Yang. 1986. An approach to the G-banding technique in rye chromosome. Acta Bot. Sin. 28: 595–598.
CCDB · ipcn-api-dl — Szeles, A. 1984. Effect of nitrous oxide on plant cell division: the cytological side-effect of N2O treatment. Acta Biol. (Szeged 1955+) 29: 23–32.
CCDB · ipcn-api-dl — Tanaka, R. & S. Ohta. 1982. A method for differential staining of centromere regions of plant chromosomes. Jap. J. Genet. 57: 65–73.
CCDB · ipcn-api-dl — Dille, J. E., E. N. King & M. Bright. 1986. Morphological and cytogenetic effects of isotox 25 seed treater (F) (lindane and captan) on roots and chromosomes of rye (Secale cereale L.). Cytologia 51: 489–492.
CCDB · ipcn-api-dl — Zhang, Z. 1982. Chromosome observation of three Ranunculaceous genera in relation to their systematic positions. Acta Phytotax. Sin. 20: 402–408.
CCDB · ipcn-api-dl — Zhang, Z., G. Dong, H. H. Zhang & Y. Lu. 1985. Fluorescence banding in several species of plants. Acta Bot. Sin. 27: 460–464.
CCDB · ipcn-api-dl — Semenov, V. I. 1986. Vnutrikhromosomnaja topografija geterokhromatina u zlakovykh. Bjulleten' Glavnogo Botanic|5eskogo Sada 140: 68–73.
CCDB · ipcn-api-dl — Chen, R. y. 1988. G-Band staining of chromosomes in some higher plants with special reference to Lilium davidii. Kromosomo 50: 1635–1651.
CCDB · ipcn-api-dl — Dille, J. E. 1988. A technique for C-banding plant chromosomes with Wright stain. Stain Technol. 63: 271–275.
CCDB · ipcn-api-dl — Figueiras, A. M., M. T. Gonzalez-Jaen, M. Candela & C. Benito. 1988. Genic heterozygosity maintained by chromosomal interchanges in rye. Heredity 60: 47–54.
CCDB · ipcn-api-dl — Limin, A. E. & D. B. Fowler. 1988. Cold hardiness expression in interspecific hybrids and amphiploids of the Triticeae. Genome 30: 361–365.
CCDB · ipcn-api-dl — Lu, B. r., B. Salomon & R. v. Bothmer. 1990. Cytogenetic studies of progeny from the intergeneric crosses Elymus @x Hordeum and Elymus @x Secale. Genome 33: 425–432.
CCDB · ipcn-api-dl — Mahulkar, N. & U. S. Chaudhari. 1989. Giemsa-banding of pro-metaphase chromosomes in Secale cereale (rye). Proc. Indian Sci. Congr. Assoc. 76(3,VI): 180.
CCDB · ipcn-api-dl — Noguchi, J. & K. Fukui. 1995. Chromatin arrangements in intact interphase nuclei examined by laser confocal microscopy. J. Pl. Res. 108: 209–216.
CCDB · ipcn-api-dl — Alonso-Blanco, C., A. M. Pendăs, R. Garcia-Suarez, A. Roca, P. G. Goicoechea & R. Giraldez. 1994. Physical mapping of 5S rDNA reveals a new locus on 3R and unexpected complexity in a rye translocation used in chromosome mapping. Chromosoma 103: 331–337.
CCDB · ipcn-api-dl — Murray, B. G. 1994. Heterochromatin and silver banding of rye (Secale cereale, Gramineae) chromosomes. Pl. Syst. Evol. 193: 243–248.
CCDB · ipcn-api-dl — Cui, L. h., Z. m. Hu, L. l. Wang, L. c. Li & Z. h. Chen. 1997. Microdissection and recovery of 1R chromosome in rye (Secale cereale). Acta Bot. Sin. 39(8): 697–700.
CCDB · ipcn-api-dl — Mujeeb-Kazi, A., Q. Jahan & A. A. Vahidy. 1994. Application of a somatic and meiotic cytological technique to diverse plant genera and species in the Triticeae. Pakistan J. Bot. 26: 353–366.
CCDB · ipcn-api-dl — Qi, Z. j., H. g. Wang, Q. q. Li, J. r. Gao & G. t. Chen. 1998. Crossability of some wheat cultivars (lines) with rye and chromosome paring ability of their hybrids. J. Shandong Agric. Univ. 29(4): 435–442.
CCDB · ipcn-api-dl — Bennet, M. D., J. P. Gustafson & J. B. Smith. 1977. Variation in nuclear DNA in the genus Secale. Chromosoma 61: 149–176.
CCDB · ipcn-api-dl — Singh, R. J. & G. Robbelen. 1977. Identification by giemsa technique of the translocations separating cultivated rye from three wild species of Secale. Chromosoma 59: 217–225.
CCDB · ipcn-api-dl — Stack, S. M. & D. E. Comings. 1979. The chromosomes and DNA of Allium cepa. Chromosoma 70: 161–181.
CCDB · ipcn-api-dl — Sybenga, J. & H. M. Verhaar. 1975. Meiotic behaviour of single-arm tetrasomic combinations of isochromosomes, telocentrics and normal chromosomes in rye (Secale cereale L.). Chromosoma 53: 295–320.
CCDB · ipcn-api-dl — Zeller, F. J., G. Kimber & B. S. Gill. 1977. The identification of Rye trisomics by transloctions and giemsa staining. Chromosoma 62: 279–289.
CCDB · ipcn-api-dl — De La Pena, A., M. J. Puertas & F. Merino. 1981. Bimeiosis induced by caffeine. Chromosoma 83: 241–248.
CCDB · ipcn-api-dl — Jones, G. H. 1978. Giemsa C-banding of rye meiotic chromosomes and the nature of terminal chiasmata. Chromosoma 66: 45–57.
CCDB · ipcn-api-dl — Ørgaard, M. & J. S. Heslop-Harrison. 1994. Relationships between species of Leymus, Psathyrostachys and Hordeum (Poaceae, Triticeae) inferred from Southern hybridization of genomic and cloned DNA probes. Pl. Syst. Evol. 189: 217–231.
CCDB · ipcn-api-dl — Jahan, Q., N. Ter-Kuile, N. Hashmi, M. Aslam, A. A. Vahidy & A. Mujeeb-Kazi. 1990. The status of the IB/IR translocation chromosome in some released wheat varieties and the 1989 candidate varieties of Pakistan. Pakistan J. Bot. 22: 1–10.
CCDB · ipcn-api-dl — Frederiksen, S. 1993. Taxonomic studies in some annual genera of the Triticeae (Poaceae). Nordic J. Bot. 13: 481–493.
CCDB · book-ipcn66 — Bowden 1966b
CCDB · book-ipcn67-71 — BENNETT, M.D., H. REES. 1969. Induced and developmental variatior in chromosomes of meristematic cells. Chromosoma 27: 226-244
CCDB · book-ipcn67-71 — WAGENAAR, E.B. 1969. End-to-end chromosome attachments in mitotic interphase and their possible significance to meiotic chromosome pairing. Chromosoma 26: 410-426.
+5 more references
2n 282×CCDB · book-ipcn67-71 · CCDB · book-indian_vol2
CCDB · book-ipcn67-71 — SCHOOLER, A. B. 1967. Intergeneric hybrids between allohexaploid (Hordeum depressum x H. compressum) and autotetraploid svalof rye ( Secale cereale J Bot. Gaz. 128: 113-116.
CCDB · book-indian_vol2 — Gulcao, R. & Sybenga, J. 1967 ; . Schooler, A.B. 1967
2n 161×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Nakao M. 1911 ; Bally, W. 1912
2n 181×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Nakajima; G. 1937a
n 74×CCDB · ipcn-api-dl · CCDB · Cave1956supp
CCDB · ipcn-api-dl — Rickards, G. K. 1986. Position and orientation in the metaphase equator of an interchange quadrivalent of hybrid rye. Chromosoma 94: 249–252.
CCDB · ipcn-api-dl — Spies, J. J., T. H. Burger & S. M. C. v. Wyk. 1999. Chromosome studies on African plants. 12. The tribes of subfamily Pooideae. Bothalia 29(2): 335–341.
CCDB · Cave1956supp — Price 1955
CCDB · Cave1956supp — Pienaar 1955
n 81×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Niwa, K., S. Ohta & S. Sakamoto. 1990. B chromosomes of Secale cereale L. and S. montanum Guss. from Turkey. Jap. J. Breed. 40: 147–152.
n 141×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Santos, J. L., M. C. Cuadrado, M. Dĭez, C. Romero, N. Cun|9ado, T. Naranjo & M. Martinez. 1995. Further insights on chromosomal pairing of autopolyploids: a triploid and tetraploids of rye. Chromosoma 104: 298–307.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness79.7% BUSCO
08Occurrence & distribution
Record type27 044 records
Wild obs. + sensor15 173
Museum / vouchered8 268
Cultivated / captive1 700
Other1 903
Origin
Native47
Introduced597
Range
Area of Occupancy AOO60 284 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy60% within 1 km
≤100 m 4 860≤1 km 2 300≤10 km 4 534>10 km 175
11 869 georeferenced · 3 304 without coordinates
Open the mapobservation + sensor15 173
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 488≤1 km 1 762≤10 km 3 124>10 km 345
5 719 georeferenced · 2 549 without coordinates
Open the institutions mapphysical evidence8 268
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy25% within 1 km
≤1 km 124≤10 km 292>10 km 71
487 georeferenced · 1 213 without coordinates
Open the mapnot free-living1 700
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions184 of 335 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 825 |
| ESP004location not on record | 471 |
| Centro Internacional de Mejoramiento de Maíz y Trigolocation not on record | 310 |
| ROM007location not on record | 121 |
| Helsinki, FI | 111 |
| LDlocation not on record | 94 |
| UniKSlocation not on record | 85 |
| Uniwersytet Warszawskilocation not on record | 80 |
| Moscow State Universitylocation not on record | 72 |
| Karlsruhe, DE | 69 |
| SWE054location not on record | 63 |
| South Kensington, GB | 63 |
| POL003location not on record | 58 |
| MeiseBGlocation not on record | 55 |
| Jyväskylä, FI | 53 |
| Riverside, US | 52 |
| Oskarshamn, SE | 51 |
| Denver, US | 51 |
| Olocation not on record | 50 |
| HUN003location not on record | 45 |
| International Salmonella Centre (W.H.O.)location not on record | 45 |
| Madison, US | 40 |
| Chongqing Museumlocation not on record | 38 |
| WTUlocation not on record | 38 |
| Yangling, CN | 37 |
| Tartu, EE | 37 |
| Bronx, US | 36 |
| Logan, US | 33 |
| Corvallis, US | 33 |
| Beijing, CN | 31 |
| Görlitz, DE | 31 |
| Uppsala, SE | 30 |
| Trondheim, NO | 30 |
| Ann Arbor, US | 29 |
| Saint Louis, US | 29 |
| SLU Artdatabankenlocation not on record | 28 |
| St. Paul, US | 27 |
| Davis, US | 27 |
| AUT001location not on record | 26 |
| Pullman, US | 25 |
| Museo Entomologico de Leonlocation not on record | 24 |
| San Diego, US | 24 |
| SVK001location not on record | 24 |
| Claremont, US | 23 |
| Flagstaff, US | 23 |
| Mount Annan, AU | 23 |
| Bergen, NO | 21 |
| Kuopio, FI | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 20 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 20 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 20 |
| Mlocation not on record | 19 |
| Auckland, NZ | 19 |
| Philadelphia, US | 19 |
| BDBClocation not on record | 18 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 18 |
| Canberra, AU | 18 |
| Barcelona, ES | 17 |
| Provincia di Livornolocation not on record | 17 |
| Chadron, US | 17 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 17 |
| Garðabær, IS | 16 |
| Bern, CH | 16 |
| Wuzhou, CN | 16 |
| Berlin, DE | 15 |
| Canadian Department of Agriculturelocation not on record | 15 |
| Irkutsk State Universitylocation not on record | 15 |
| College Park, US | 14 |
| Oulu, FI | 14 |
| IDElocation not on record | 14 |
| TUR-Alocation not on record | 14 |
| Christchurch, NZ | 14 |
| Québec, CA | 14 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 13 |
| Vancouver, CA | 13 |
| Hobart, AU | 13 |
| Boise, US | 13 |
| KMNlocation not on record | 13 |
| Odawara, JP | 13 |
| Université Lavallocation not on record | 13 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 12 |
| Allentown, US | 12 |
| MAlocation not on record | 11 |
| Williamsburg, US | 11 |
| Burlington, US | 11 |
| BFLlocation not on record | 11 |
| Arcata, US | 11 |
| Santa Barbara, US | 11 |
| Moscow, US | 10 |
| Porvoo, FI | 10 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| BClocation not on record | 10 |
| University of Stellenboschlocation not on record | 10 |
| Turku, FI | 10 |
| Badajoz, ES | 9 |
| ASUlocation not on record | 9 |
| Dresden, DE | 9 |
| University of Alberta Museumslocation not on record | 9 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 9 |
| Entomological Society of Latvialocation not on record | 9 |
| Millersville, US | 9 |
| University of New Hampshirelocation not on record | 8 |
| San Luis Obispo, US | 8 |
| Fort Worth, US | 8 |
| Bangkok, TH | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| Tampa, US | 7 |
| CICYTEXlocation not on record | 7 |
| Emporia, US | 7 |
| Dekalb, US | 7 |
| Córdoba, AR | 7 |
| Nanjing, CN | 7 |
| Pocatello, US | 7 |
| Kensington, AU | 7 |
| Tallinn, EE | 7 |
| ROM023location not on record | 7 |
| CASlocation not on record | 7 |
| València, ES | 6 |
| Missoula, US | 6 |
| Zürich, CH | 6 |
| Salzburg, AT | 6 |
| Sichuan Agricultural Universitylocation not on record | 6 |
| Nagano City, JP | 6 |
| Bozeman, US | 6 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 6 |
| Tilburg, NL | 6 |
| NSMKlocation not on record | 5 |
| Austin, US | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Cape Town, ZA | 5 |
| Sanda, JP | 5 |
| Whitehorse, CA | 5 |
| Mexico City, MX | 5 |
| Kushiro City Museumlocation not on record | 5 |
| Córdoba, ES | 5 |
| Adelaide, AU | 5 |
| Victoria, CA | 5 |
| Jackson, US | 5 |
| Tuscaloosa, US | 5 |
| Kew, GB | 5 |
| Jena Microbial Resource Collectionlocation not on record | 5 |
| Acadia Universitylocation not on record | 5 |
| Mexico City, MX | 5 |
| San Jose, US | 5 |
| Guangzhou, CN | 4 |
| Bloomington, US | 4 |
| Frankfurt am Main | 4 |
| WNNUlocation not on record | 4 |
| Lubbock, US | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Keene State Universitylocation not on record | 4 |
| GBR165location not on record | 4 |
| BAYLUlocation not on record | 4 |
| SIHUlocation not on record | 4 |
| Brisbane, AU | 4 |
| Taipei, TW | 4 |
| Clemson, US | 4 |
| Bend, US | 4 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| Pittsburg, US | 4 |
| US | 4 |
| BRNUlocation not on record | 4 |
| Albuquerque, US | 4 |
| Tula State Universitylocation not on record | 4 |
| Xiamen, CN | 4 |
| Chapel Hill, US | 4 |
| Sion, CH | 4 |
| Chengdu, CN | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Angwin, US | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Davenport, US | 3 |
| TROMlocation not on record | 3 |
| Montecillo, Texcoco, MX | 3 |
| Weber State Universitylocation not on record | 3 |
| Eastern Nevada Landscape Coalitionlocation not on record | 3 |
| Frauenfeld, CH | 3 |
| Little Rock, US | 3 |
| Spearfish, US | 3 |
| Caldwell, US | 3 |
| Zürich, CH | 3 |
| Guilin, CN | 3 |
| Portland, US | 3 |
| USFSlocation not on record | 3 |
| Columbia, US | 3 |
| Vitoria, ES | 3 |
| Durham, US | 3 |
| Phoenix, US | 3 |
| Norfolk, US | 3 |
| Kochi, JP | 3 |
| McWane Science Centerlocation not on record | 3 |
| GJOlocation not on record | 3 |
| AZE003location not on record | 3 |
| Yunnan Universitylocation not on record | 3 |
| Toronto, CA | 3 |
| Zapopan, MX | 3 |
| Shinshu Universitylocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| CJBNlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Cape Town, ZA | 2 |
| AUAlocation not on record | 2 |
| Coimbra, PT | 2 |
| PUC-RSlocation not on record | 2 |
| WINlocation not on record | 2 |
| Granada, ES | 2 |
| Armidale, AU | 2 |
| Staten Island, US | 2 |
| CZE047location not on record | 2 |
| GZUlocation not on record | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Tomioka, JP | 2 |
| Wlocation not on record | 2 |
| Alicante, ES | 2 |
| KURAlocation not on record | 2 |
| Rovaniemi, FI | 2 |
| ARM059location not on record | 2 |
| Durango, MX | 2 |
| Montréal, CA | 2 |
| Universidade de Passo Fundolocation not on record | 2 |
| Salamanca, ES | 2 |
| Wuhan, CN | 2 |
| Orem, US | 2 |
| Henderson, US | 2 |
| Madrid, ES | 2 |
| Pamplona, ES | 2 |
| 2 | |
| Tsukuba, JP | 2 |
| Fulda, DE | 2 |
| New Haven, US | 2 |
| Lincoln, US | 2 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Knoxville, US | 1 |
| IFR-DNFlocation not on record | 1 |
| Irvine, US | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Saint John, CA | 1 |
| KOMlocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| BSBIlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Cheney, US | 1 |
| Porrentruy, CH | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Yukon Universitylocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| GB | 1 |
| GMBAlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Chapingo, MX | 1 |
| Taipei, TW | 1 |
| NMWlocation not on record | 1 |
| Glarus, CH | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Xining, CN | 1 |
| Zhengzhou, CN | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Provo, US | 1 |
| Urumqi, CN | 1 |
| Los Angeles, US | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Paris, FR | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| nlocation not on record | 1 |
| Changsha, CN | 1 |
| Valdosta State Universitylocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Richmond, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Miami, US | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Kyoto Universitylocation not on record | 1 |
| KIRMlocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| UChlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| BGR001location not on record | 1 |
| KNFSClocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| PRClocation not on record | 1 |
| Northridge, US | 1 |
| Lanzhou, CN | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| GAlocation not on record | 1 |
| DMZ botanic gardenlocation not on record | 1 |
| Firenze, IT | 1 |
| Chicago, US | 1 |
| EL PASO, US | 1 |
| Trois-Rivières, CA | 1 |
| Podgorica, ME | 1 |
| Santa Cruz, US | 1 |
| VALElocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| New Brunswick, US | 1 |
| Grand Junction, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| Wellington, NZ | 1 |
| Philadelphia, US | 1 |
| Denton, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Ashland, US | 1 |
| Bourges, FR | 1 |
| Morgantown, US | 1 |
| Fayetteville, US | 1 |
| Chicago, US | 1 |
| ISAlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Palmerston North, NZ | 1 |
| Brussel, BE | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Henderson State Universitylocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Loja, EC | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Minia, EG | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Fairfax, US | 1 |
335 institutions · 7 949 of 8 268 vouchered records shown · 242 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA15 detections
Where the DNA of Secale cereale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map3 countries0
along dike on banks of the Stewart River wit…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 11.2–16.3
Seasonal swing summer↔winter23.1 °C
Max temp (day)18.6 °C 17.0–21.7
Min temp (night)9.50 °C 5.20–11.8
Precipitation63.9 mm/mo 26.9–101
Air humidity56.7 % 52.1–59.4
Moisture balance-59.3 mm/mo -113–-7.70
Vapour deficit707 Pa 649–800
Wind speed2.40 m/s 1.80–3.90
Cloud cover39.5 % 32.5–44.1
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.