Sebastes fasciatus

Storer, 1854 · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Sebastidae/Sebastes

At a glance

Occurrence records24 044

Data sources7

Biological traits0

DNA specimens15

eDNA detections4 214

Sources7 archives

Databases and archives Sebastes fasciatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility12 011 records↗

OBISOcean Biodiversity Information System12 033 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 214 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF · OBIS24 044 records

Environmental DNA4 datasets · 1 countries4 214 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceGoaT≈834 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sebastes fasciatus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections4 214

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.11%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 5 variable positions, in barcode order

532Tmostly conserved

642Amostly conserved

643Cmostly conserved

645Amostly conserved

646Gmostly conserved

CCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sebastes alutussame genus1.7%Sebastes reedisame genus2.1%Sebastes borealissame genus2.3%Sebastes polyspinissame genus2.3%Sebastes brevispinissame genus2.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_036048 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Sebastes fasciatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈833 835 073 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sebastes fasciatus0.83 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type24 044 records

Wild obs. + sensor22 761

Museum / vouchered1 277

Other6

Range

Area of Occupancy AOO27 052 km²

Depth

0–200 m sunlit4 031

200–1000 m twilight803

1–4 km midnight1

>4 km abyssal0

median 130.2 m · max 3 303.5 m · 4 835 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 52≤1 km 3 406≤10 km 10>10 km 74

3 542 georeferenced · 19 219 without coordinates

Open the mapobservation + sensor22 761

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 30≤1 km 2≤10 km 7>10 km 38

77 georeferenced · 1 200 without coordinates

Open the institutions mapphysical evidence1 277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The Atlantic reference Centrelocation not on record	136
FishBaselocation not on record	92
Toronto, CA	60
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	33
Cambridge, US	23
Washington, US	12
Wuzhou, CN	3
Zoologisches Museum Hamburglocation not on record	2
Maurice Lamontagne Institutelocation not on record	2
North Carolina Museum of Natural Scienceslocation not on record	2
Ann Arbor, US	1

11 institutions · 366 of 1 277 vouchered records shown · 254 without an institution code

09Environmental DNA4 214 detections

Where the DNA of Sebastes fasciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4 214

Studies independent surveys4

Countries1

Verifiable raw sequence linked113

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 214 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 17.4–17.6

Seasonal swing summer↔winter20.8 °C

Max temp (day)18.2 °C 18.1–18.4

Min temp (night)16.8 °C 16.7–16.9

Precipitation98.2 mm/mo 96.3–101

Air humidity68.1 % 67.7–68.7

Vapour deficit632 Pa 618–640

Cloud cover48.7 % 46.1–49.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 214 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sebastes fasciatus

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type24 044 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type24 044 records