Scutellinia olivascens

(Cooke) Kuntze · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Pyronemataceae/Scutellinia

At a glance

Occurrence records334

Data sources9

Biological traits0

DNA specimens2

eDNA detections84

Sources9 archives

Databases and archives Scutellinia olivascens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility334 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI84 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF334 records

Environmental DNA3 datasets · 12 countries84 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Scutellinia olivascens is a species of apothecial fungus belonging to the family Pyronemataceae. This European fungus forms clusters of orange discs up to 1.5 cm in diameter on soil or rotting wood in summer and autumn. It is very similar to the common species Scutellinia umbrorum and can only be reliably identified by microscopic features. The species was described in 1876 by Mordecai Cooke as Peziza olivascens, but Otto Kuntze revised the genus to Scutellinia in 1891.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scutellinia olivascens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections84

Countries12

The DNA barcodea real sequence read deposited for this species

ITSOP749073.1 ↗645 bpUSA · 2022

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAGTAAAAAAGATATCGTATTCCCTCGAATATGCGTGTTTTTTTT …

Scutellinia olivascens isolate S.D. Russell ONT iNaturalist 136703676 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type334 records

Wild obs. + sensor188

Museum / vouchered146

Range

Area of Occupancy AOO992 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 19≤1 km 14≤10 km 129>10 km 2

164 georeferenced · 24 without coordinates

Open the mapobservation + sensor188

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 5≤1 km 23≤10 km 17

45 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	43
Tartu, EE	37
Olocation not on record	21
Trondheim, NO	8
Copenhagen, DK	6
Salzburg, AT	2
Zürich, CH	2
San Sebastián, ES	2
Mlocation not on record	1
GJOlocation not on record	1
Philadelphia, US	1
Kew, GB	1
LDlocation not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
WU-MYClocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Catholic University of Pekinglocation not on record	1
SLU Artdatabankenlocation not on record	1

19 institutions · 132 of 146 vouchered records shown · 13 without an institution code

09Environmental DNA84 detections

Where the DNA of Scutellinia olivascens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found84

Studies independent surveys3

Countries12

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 84 detections have coordinates

Open the map12 countries0

PalearcticNearcticAfrotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.6 °C 5.60–17.4

Seasonal swing summer↔winter22.4 °C

Max temp (day)13.9 °C 8.80–21.2

Min temp (night)6.70 °C 1.70–15.1

Precipitation81.4 mm/mo 46.7–225

Air humidity62.6 % 57.1–67.8

Moisture balance6.10 mm/mo -59.1–98.7

Vapour deficit484 Pa 365–830

Wind speed2.80 m/s 1.90–4.60

Cloud cover40.2 % 27.8–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 84 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)