Scutellaria nana

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Scutellaria

At a glance

Occurrence records461

Data sources8

Biological traits13

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Scutellaria nana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility461 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF461 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Scutellaria nana is a species of flowering plant in the mint family known by the common names dwarf skullcap and dwarf scullcap. It is native to the western United States, especially in and around the Great Basin. It grows in plateau scrub, often on volcanic soils.S. nana A. Gray, treatment for SCUTELLARIA nana It is a small perennial herb producing one or more erect stems up to about 20 centimeters tall from a rhizome. It is coated in tiny flat hairs which sometimes have resin glands. The leaves are oval or diamond-shaped, the lower ones borne on short petioles. Flowers occur in the leaf axils, each borne in a calyx of sepals with a prominent ridge on the upper surface. The corolla is up to 2 centimeters long, tubular in shape, and generally white or yellowish with purple mottling on the lips. Like several other skullcap species, this plant is used medicinally.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.961 mg

Seed mass max0.96 mg

Seed mass min0.96 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scutellaria nana has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSMW396622.1 ↗6 232 bp

ACGT

CGGATCCCTGCTCTGGCAGCGACGGCACCTCCAACCGGCCTCTTCAATCGTCGGCACGAGCGCTCCCTTGCCTCGGTCGATGTCGGTTTC …

Scutellaria nana isolate PE008 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Scutellaria nana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Olmstead, R. G. 1990. Systematics of the Scutellaria angustifolia complex (Labiatae). Contr. Univ. Michigan Herb. 17: 223–265.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type461 records

Wild obs. + sensor128

Museum / vouchered333

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 80≤1 km 6≤10 km 2>10 km 7

95 georeferenced · 33 without coordinates

Open the mapobservation + sensor128

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 14≤1 km 97≤10 km 55>10 km 6

172 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence333

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	68
Corvallis, US	53
Caldwell, US	25
WTUlocation not on record	19
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	13
CASlocation not on record	12
Moscow, US	10
Claremont, US	10
Pullman, US	9
Angwin, US	8
Wuzhou, CN	7
US	7
Arcata, US	5
San Francisco, US	5
Santa Barbara, US	4
VALElocation not on record	4
Ashland, US	4
Boise, US	4
San Jose, US	4
Provo, US	3
Henderson, US	3
Flagstaff, US	3
Logan, US	3
Bend, US	2
Riverside, US	2
Los Angeles, US	2
Phoenix, US	2
Chadron, US	2
Musee des Dinosaures d'Esperaza (Aude)location not on record	2
Pocatello, US	2
DOI/NPS, Colonial National Historical Parklocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Bloomington, US	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
KNFHClocation not on record	1
KNFYlocation not on record	1
Eastern Nevada Landscape Coalitionlocation not on record	1
Davis, US	1
Wellington, NZ	1

40 institutions · 307 of 333 vouchered records shown · 26 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)