Scutellaria multiglandulosa

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Scutellaria

At a glance

Occurrence records191

Data sources6

Biological traits10

DNA specimens1

eDNA detections0

Sources6 archives

Databases and archives Scutellaria multiglandulosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility191 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF191 records

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Scutellaria multiglandulosa is a flowering plant in the genus Scutellariaand family Lamiaceae. It grows in parts of the Southeastern United States. It is sometimes referred to by the common name Small's skullcap.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scutellaria multiglandulosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKY627074.1 ↗557 bp

ACGT

AGACTAAAGCAAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACCCCTGAATATGAAACCAAGGATACTGATA …

Scutellaria multiglandulosa voucher FLAS:Majure 4940 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3rbcL2

plant barcode

08Occurrence & distribution

Record type191 records

Wild obs. + sensor114

Museum / vouchered77

Range

Area of Occupancy AOO532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 71≤1 km 5≤10 km 6>10 km 16

98 georeferenced · 16 without coordinates

Open the mapobservation + sensor114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 6≤1 km 1≤10 km 1>10 km 5

13 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	21
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	12
Tampa, US	9
Tall Timbers Research Stationlocation not on record	8
Valdosta State Universitylocation not on record	7
Miami, US	4
University of Stellenboschlocation not on record	3
Bronx, US	2
Saint Louis, US	2
Bangkok, TH	2
Tempe, US	2
Florida Museum of Natural Historylocation not on record	1
GAlocation not on record	1
Wuzhou, CN	1
Chapel Hill, US	1
McWane Science Centerlocation not on record	1

16 institutions · 77 of 77 vouchered records shown