Scutellaria mexicana

(Torr.) A.J.Paton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Scutellaria

At a glance

Occurrence records4 065

Data sources9

Biological traits21

DNA specimens4

eDNA detections1

Sources9 archives

Databases and archives Scutellaria mexicana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 065 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF4 065 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Scutellaria mexicana, commonly known by variants on bladder sage or paperbag bush, is a shrub of the mint family Lamiaceae distinctive for its calyx lobes that develop into small bag- or bladder-like shells around the fruits.Mojave Desert Wildflowers, Pam MacKay, 2nd ed., p.58

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height1.21 m

Seed mass1.58 mg

Seed mass max1.58 mg

Seed mass min1.58 mg

Life cycle & reproduction5

Deciduousnessevergreen

Life formsubshrub

Life spanperennial

Lifespan years33 years

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry5

Leaf dry-matter content (LDMC)306 mg/g

Leaf n26.86 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)67.37 mm²/mg

Wood density582 mg/cm³

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scutellaria mexicana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW396618.1 ↗6 234 bp

ACGT

GCGTGTCGGATCCCTGCTCGGGCAGCGACGGCATCTCCAACCGGCCTCTTCAATAGTCGGCACGAGAGCTCTCTTGCCTCGGCCGATGTC …

Scutellaria mexicana isolate WTUL018 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type4 065 records

Wild obs. + sensor3 524

Museum / vouchered541

Origin

Native38

Range

Area of Occupancy AOO6 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 967≤1 km 247≤10 km 145>10 km 168

2 527 georeferenced · 997 without coordinates

Open the mapobservation + sensor3 524

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 27≤1 km 71≤10 km 107>10 km 10

215 georeferenced · 326 without coordinates

Open the institutions mapphysical evidence541

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	107
Claremont, US	74
Riverside, US	66
WTUlocation not on record	44
Los Angeles, US	32
Davis, US	27
CASlocation not on record	26
Santa Barbara, US	25
US	21
EL PASO, US	16
San Luis Obispo, US	12
Long Beach, US	12
Saint Louis, US	11
Severin-McDaniel Insect Collectionlocation not on record	8
University of Stellenboschlocation not on record	7
Northridge, US	6
Guasave, MX	6
ASUlocation not on record	5
San Angelo, US	5
Irvine, US	4
San Jose, US	3
Phoenix, US	2
Eastern Nevada Landscape Coalitionlocation not on record	2
San Bernardino, US	1
Wellington, NZ	1
San Diego Natural History Museum, Herbariumlocation not on record	1
San Diego Natural History Museumlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Albuquerque, US	1
Vancouver, CA	1

31 institutions · 529 of 541 vouchered records shown · 12 without an institution code

09Environmental DNA1 detections

Where the DNA of Scutellaria mexicana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

L tridentata, A deserti, J californica, Ence…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 18.2–18.2

Seasonal swing summer↔winter18.6 °C

Max temp (day)25.6 °C

Min temp (night)11.2 °C

Precipitation15.1 mm/mo

Air humidity45.8 %

Moisture balance-125 mm/mo

Vapour deficit1,142 Pa

Wind speed3.50 m/s

Cloud cover33.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Scutellaria mexicana

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction5

Diet & foraging1

Habitat & environment6

Physiology & chemistry5

At a glance

Record type4 065 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 065 records