Scutellaria californica — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Scutellaria

At a glance

Occurrence records651

Data sources9

Biological traits13

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Scutellaria californica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility651 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF651 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Scutellaria californica, the California skullcap, is a species of plant endemic to California. It is found in the scrub and low elevation mountains of Northern California. It is a small plant growing up to half a meter high, bearing small, white or yellowish snapdragon-like flowers which are said to smell of apples. The leaves are green and arranged oppositely on the erect stem.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.793 mg

Seed mass max0.793 mg

Seed mass min0.793 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scutellaria californica has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLPQ075909.1 ↗152 418 bp

ACGT

TGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTACTATAAA …

Scutellaria californica isolate S239 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Scutellaria californica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Olmstead, R. G. 1990. Systematics of the Scutellaria angustifolia complex (Labiatae). Contr. Univ. Michigan Herb. 17: 223–265.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.997 ↗

08Occurrence & distribution

Record type651 records

Wild obs. + sensor288

Museum / vouchered363

Origin

Native14

Range

Area of Occupancy AOO1 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 135≤1 km 33≤10 km 14>10 km 12

194 georeferenced · 94 without coordinates

Open the mapobservation + sensor288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 5≤1 km 140≤10 km 79>10 km 3

227 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence363

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	71
Davis, US	36
Arcata, US	32
Angwin, US	25
Claremont, US	15
San Diego, US	13
Riverside, US	11
Santa Barbara, US	8
Canadian Department of Agriculturelocation not on record	7
Los Angeles, US	4
CASlocation not on record	3
Truckee, US	3
EL PASO, US	2
Bronx, US	2
STNFlocation not on record	2
San Luis Obispo, US	2
Columbia, US	2
Henderson, US	1
Provo, US	1
Wuzhou, CN	1
San Jose, US	1
Chongqing Museumlocation not on record	1
San Francisco, US	1
Mississippi State, US	1
Northridge, US	1
Fort Bragg, US	1
Boise, US	1
Ashland, US	1
US	1
Bloomington, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
ASUlocation not on record	1

32 institutions · 253 of 363 vouchered records shown · 110 without an institution code