Scutellaria brachyspica

Nakai & H.Hara · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Scutellaria

At a glance

Occurrence records720

Data sources7

Biological traits8

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Scutellaria brachyspica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility720 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF720 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 26

01Narrative

Scutellaria brachyspica is a species of flowering plant in the mint family (Lamiaceae). It is endemic to Japan, where it is found on the islands of Honshu (south of Miyagi Prefecture) and Shikoku.Scutellaria brachyspica (in Japanese), Flora of MikawaScutellaria brachyspica Prof. Summer's Web Garden: Japanese Wild Flowers It is a common species in Japan. Its natural habitat is in is in forest edges in hilly areas. Scutellaria brachyspica is a perennial, growing to 50 cm tall. Its blue-white flowers are clustered in a short terminal spikes. It blooms from May to June. The plant has a diploid number of 26.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scutellaria brachyspica has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC635359.1 ↗604 bpJapan · 2017

ACGT

AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACCCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGC …

Scutellaria brachyspica P4610 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Scutellaria brachyspica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sawanomukai, T., Y. Iwatsubo & N. Naruhashi. 2003. Chromosome numbers of Japanese Scutellaria (Lamiaceae). J. Phytogeogr. Taxon. 51: 131–136.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.998 ↗

08Occurrence & distribution

Record type720 records

Wild obs. + sensor46

Museum / vouchered674

Range

Area of Occupancy AOO1 860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 29>10 km 2

31 georeferenced · 15 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 14

14 georeferenced · 660 without coordinates

Open the institutions mapphysical evidence674

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sanda, JP	243
Odawara, JP	100
Tsukuba, JP	77
Bando, JP	70
KURAlocation not on record	24
Tokushima, JP	24
Kawasaki Shi Tama Ku, JP	23
Chiba, JP	22
Nagano City, JP	20
Sagamihara, JP	17
Osaka, JP	16
FFPRIlocation not on record	9
Toyama, JP	7
Toyota city nature sanctuarylocation not on record	6
Sendai, JP	3
KIRMlocation not on record	2
Nishihara, JP	2
Shinshu Universitylocation not on record	2
KOMlocation not on record	1
Beijing, CN	1
Tomioka, JP	1
J.F.Oberlin Universitylocation not on record	1
Oiso Municipal Museumlocation not on record	1
Gifu prefectural Museumlocation not on record	1
Burlington, US	1

25 institutions · 674 of 674 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)