Scutellaria albida

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Scutellaria

At a glance

Occurrence records320

Data sources7

Biological traits18

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Scutellaria albida's data was compiled from.

GBIFGlobal Biodiversity Information Facility320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources18 traits

Chemical compositionNPASS15 compounds

Occurrence & distributionGBIF320 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.5 m

Plant height min0.2 m

Seed mass0.814 mg

Seed mass max0.8 mg

Seed mass min0.8 mg

Life cycle & reproduction5

Flowering endAug

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, limestone, rivers, stony places

Woodinessnon-woody

03Chemical composition15 compounds

Compounds documented for Scutellaria albida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Gibberellins4

Apocarotenoids (β-) $ Apocarotenoids(ε-)1

Phenylethylamines1

Branched fatty acids $ Unsaturated fatty acids1

Branched fatty acids1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Phaseic acid	present	NPASS
(2E,4E,7R,8R)-8-hydroxy-2,7-dimethyldeca-2,4-dienedioic acid	present	NPASS
(2Z,4E)-5-[(3R,4R)-4-hydroxy-5,5-dimethyl-7-oxo-1-oxaspiro[2.5]octan-4-yl]-3-methylpenta-2,4-dienoic acid	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
3-Furoic acid	present	NPASS
Gibberellin A1	present	NPASS
Gibberellin A17	present	NPASS
Gibberellin A2	present	NPASS
JLJLRLWOEMWYQK-KVTGBRPYSA-N	present	NPASS
Oenanthetol acetate	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scutellaria albida has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK561745.1 ↗453 bpIran · 2014

ACGT

GTAGGTGACCTGCGGAAGGATCATTGTCGAAACCTGCAAAAAGCAGACCGCGAACACGTGTCTAACGACAACCCGGGGGCCGCGGCGGGT …

Scutellaria albida voucher TUH s.n. small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type320 records

Wild obs. + sensor216

Museum / vouchered103

Cultivated / captive1

Origin

Introduced43

Range

Area of Occupancy AOO768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 69≤1 km 62≤10 km 19>10 km 1

151 georeferenced · 65 without coordinates

Open the mapobservation + sensor216

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 3≤1 km 10≤10 km 11

24 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence103

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	34
Berlin, DE	17
LDlocation not on record	16
Adam Mickiewicz University in Poznańlocation not on record	8
BRNUlocation not on record	6
Wlocation not on record	4
WTUlocation not on record	2
Uniwersytet Śląski w Katowicachlocation not on record	1
Barcelona, ES	1
Podgorica, ME	1
Voronezh State Universitylocation not on record	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
University of Stellenboschlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Conservatoire botanique national du Bassin parisienlocation not on record	1
Pullman, US	1

16 institutions · 96 of 103 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Scutellaria albida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)